infections is bacterial bronchitis in the setting of chronic lung disease a mild infection
báo cáo khoa học: " Recurrent takotsubo cardiomyopathy in the setting of transient neurological symptoms: a case report" pptx
... dysfunction with a takotsubo-like state is often seen with intracranial pathology, including subarachnoid hemorrhage and congenital brain abnormalities in children In the setting of intracranial injury ... 226/100 mmHg) Her aphasia was isolated and transient, and her physical examination was otherwise unremarkable Because we were concerned about an acute intracerebral event in the setting of hypertensive ... Tsuchihashi K, Uesima K, Uchida T, Oh-mura N, Kimura K, Owa M, Yoshiyama M, Miyazaki S, Haze K, Ogawa H, Honda T, Hase M, Kai R, Morii I, Angina Pectoris-Myocardial Infarction Investigations in Japan:...
- 4
- 357
- 0
Báo cáo y học: "Commonly applied positive end-expiratory pressures do not prevent functional residual capacity decline in the setting of intra-abdominal hypertension: a pig model" pot
... did not increase PaO2 values in IAH The minimal PaO2 decrease as compared to the relatively larger FRC decrease in the setting of raised IAP can be explained by the FRC not dropping below the Regli ... on bacterial translocation J Trauma 2002, 52:13-17 Kitano Y, Takata M, Sasaki N, Zhang Q, Yamamoto S, Miyasaka K: Influence of increased abdominal pressure on steady-state cardiac performance ... kg Haemoglobin concentration was 103 (8) g/L After inflation of the intra-abdominal balloon to the target IAP, the IAP remained constant over the five-minute stabilising period The resulting...
- 11
- 406
- 0
Báo cáo y học: " Comparison of the efficacy of lamivudine and telbivudine in the treatment of chronic hepatitis B: a systematic review" pdf
... HBV infection varies greatly in different parts of the world Based on the prevalence of HBV surface antigen(HBsAg) carrier rate in the general population, sub-Saharan African, East Asian and Alaskan ... made substantial contributions to its design, acquisition, analysis and interpretation of data LZC, and XHD, participated in the design, acquisition, analysis and interpretation of data All authors ... chronic hepatitis B virus infection with evidence of hepatitis (alanine aminotransferase (ALT) elevation of at least one and a half times the upper limit of normal range) and of viral replication...
- 11
- 398
- 0
Starting ARVs in the setting of Opportunistic Infections pptx
... Microsporidiosis • Kaposi Sarcoma • Progressive Multifocal Lymphadenopathy (PML) Starting ARVs in the setting of an active Opportunistic Infection In other OIs, ARV therapy can exacerbate the condition ... NVP containing ARV Weerawat M et al CID 2006;43:253-5 Guidelines for Diagnosis and Treatment of HIV/AIDS, Ministry of Health, Vietnam March, 2005 16 Starting ARVs in the setting of an active Opportunistic ... months) Guidelines for Diagnosis and Treatment of HIV/AIDS, Ministry of Health, Vietnam March, 2005 30 Starting ARVs in the setting of an active Opportunistic Infection Cryptococcal Meningitis When...
- 40
- 384
- 0
Báo cáo khoa học: "Atypical presentation of angiosarcoma of the scalp in the setting of Human Immunodeficiency Virus (HIV)" pdf
... bleeding, oedema or ulceration A delay in diagnosis is common in the early stages of disease due to confusion with infection, or traumatic bruises [7] These malignancies spread radially within the ... choice for scalp angiosarcoma because the involved dermis as well as a sufficient area of surrounding skin can be treated, while sparing the brain and other normal tissue [9] Chemotherapy has been ... clinical presentation and natural history of malignant disease Case presentation A young black female presented with a month history of a mass over the posterior aspect of her scalp which was initially...
- 4
- 242
- 0
Báo cáo y học: "Cartilage degradation is fully reversible in the presence of aggrecanase but not matrix metalloproteinase activity" pdf
... assays for measuring sulphated glycosaminoglycans (S-GAGs) are available, these assays not distinguish between synthesis and degradation of the proteoglycans [19] Furthermore, they not distinguish ... cartilage was harvested at different time points Proteoglycans in the cartilage were visualized using Alcian blue staining, the same dye used in the S-GAG assay The control articular cartilage ... cutting of the cartilage may induce alternative metabolism This may influence the cartilage metabolism and thereby allow for skewed interpretations of the turnover compared with that of the in...
- 12
- 485
- 0
Báo cáo y học: " The use of partial exchange blood transfusion and anaesthesia in the management of sickle cell disease in a perioperative setting: two case reports" pot
... his vital signs and maintaining them within tight ranges Anaesthesia from the beginning up to the end of surgery lasted 80 minutes Postoperative care, including fluid management and weaning off ... this article as: Jaeckel et al.: The use of partial exchange blood transfusion and anaesthesia in the management of sickle cell disease in a perioperative setting: two case reports Journal of ... generally have a history of chronic pain and thus a history of using analgesics, some may have a tolerance to opioids When anaesthesia is no longer needed, optimal fluid balance, analgesia, normothermia...
- 6
- 438
- 0
Báo cáo khoa học: "Diagnosis of left ventricular diastolic dysfunction in the setting of acute changes in loading conditions" pdf
... vascular resistance (Table 1) Despite the absence of relevant tachycardia secondary to ultrafiltration-related intravascular volume reduction, haemodialysis induced substantial alterations in ... evolution of pulmonary vein Doppler D wave after intravascular volume withdrawal paralleled that of mitral Doppler E wave, and the S/D ratio increased after haemodialysis (Table 1), as was previously ... cardiac disease (ischaemic heart disease) All patients had normal sinus rythm and no significant (greater than grade I) valvular insufficiency In all patients, body weight, blood pressure and heart...
- 9
- 255
- 0
Báo cáo y học: " HIV-1 Rev oligomerization is not obligatory in the presence of an extra basic domain" doc
... coding region from pcrevM4 was amplified using the primer pairs tcgaagctagtcgacatctcctatg / cggggtaccgcctccttctttagctcc (PCR A) and cggggtaccggaatggcaggaagaagc / ctccagttggtagagagagcag (PCR B) The ... 3, Table 1) Figure and intracellular steady the localization of the wild type Rev The mutants is shown instate panels to the left (panels a- e) The intracellular steady state localization of the ... mutants The location of the M4 mutations are indicated by arrows The Rev basic domain is indicated as Rev-NOS, the three copies of the large T-antigen NLS are indicated as 3xNLS, the Rex overlapping...
- 8
- 316
- 0
Impact of chronic disease on quality of life among the elderly in the state of São Paulo, Brazil: a population-based study pptx
... Secretary of Health for financing the fieldwork; to the Secretary of Health Surveillance of the Ministry of Health for financial support in the data analysis through the Health Analysis Collaborative ... of Medical Sciences of the State University of Campinas, Campinas, São Paulo RESULTS The data analyzed came from a total of 958 individuals—929 males and 029 females 60 years of age or more The ... effective in managing the chronic pain that accompanies various diseases Pain is very much present in the lives of the elderly (even in cases of emotional problems) and has a markedly negative effect...
- 8
- 701
- 0
PET in the Evaluation of Alzheimer’s Disease and Related Disorders docx
... molecular participant in particular, the β-amyloid of extracellular plaques constituting one of the histopathologic hallmarks of Alzheimer’s disease, has attracted substantial attention in both industry ... receptors as an index of hippocampal pyramidal neuronal loss, might further assist in defining the patterns of dementia and brain aging and augment early detection and disease progression monitoring ... Statistical Manual of Mental Disorders, 4th ed Washington, DC: APA, 1994 Rasmusson DX, Brandt J, Steele C, et al Accuracy of clinical diagnosis of Alzheimer disease and clinical features of patients...
- 231
- 535
- 0
The Risk of Obstructive Lung Disease by Previous Pulmonary Tuberculosis in a Country with Intermediate Burden of Tuberculosis potx
... based on the classification of the National Tuberculosis and Respiratory Disease Association of the USA (14) Statistical analysis Comparisons between variables were tested using the chi-square test ... fibrosis and inflammation may play important roles TB infection is associated with airway fibrosis and the immune response to mycobacteria could cause airway inflammation, a characteristic of obstructive ... de Oca M, Talamo C, Pertuze J, Victora CG; Lat- 23 Tzanakis N, Anagnostopoulou U, Filaditaki V, Christaki P, Siafakas N; in American Project for the Investigation of Obstructive Lung Disease COPD...
- 6
- 441
- 0
Báo cáo y học: "Role of Leukotriene Receptor Antagonists in the Treatment of Exercise-Induced Bronchoconstriction: A Review" pot
... against EIB have been seen to occur as early as hour19 and up to 24 hours after a single oral dose.14,21 When montelukast is administered on a regular basis, protection against EIB is maintained ... 1999;33:1299–314 National Heart, Lung, and Blood Institute, National Asthma Education Program Guidelines for the diagnosis and management of asthma Expert Panel report II Bethesda (MD):US Department of Health ... production and mucosal edema, enhanced smooth-muscle cell proliferation, and eosinophilia that are characteristic of the asthmatic airway.6 Both bronchial and bronchoalveolar lavage studies have provided...
- 5
- 663
- 0
Báo cáo y học: "Progress and Challenges in the Understanding of Chronic Urticaria" pptx
... urticaria, just as the histology of the two groups is strikingly similar.27,45 All of these findings provide a basis for further investigation of the pathogenesis and treatment of this disease. 46–48 ... donors, the percentage that is positive is 40 to 45% Approximately 60% of patients’ sera are negative, and these remain idiopathic The pathogenic mechanisms causing urticaria in these residual 60% of ... antibodies may be implicated in the pathogenesis of autoimmune urticaria.16 On the other hand, when histamine release is performed by incubating chronic urticaria sera with the basophils of normal donors,...
- 5
- 467
- 1
Báo cáo y học: "The opposite effects of fluvoxamine and sertraline in the treatment of psychotic major depression: a case report" potx
... fluvoxamine (150 mg) monotherapy was maintained, and her condition remained good At years after the disappearance of the delusions, the patient began overeating and oversleeping, as well as experiencing ... the active mechanism of fluvoxamine, it is likely that the difference in the pharmacological actions (agonist or antagonist) of the two SSRIs at the sigma-1 receptors may have been related to the ... that activation of the dopaminergic system by the inhibition of dopamine transporter may be involved in the mechanism of unwanted effects (deterioration of psychosis) of sertarline in this case,...
- 3
- 401
- 0
Báo cáo y học: "In adult onset myositis, the presence of interstitial lung disease and myositis specific/associated antibodies are governed by HLA class II haplotype, rather than by myositis subtype" pdf
... IIMs in Caucasians, especially in patients possessing anti-aminoacyl transfer RNA (tRNA) synthetase antibodies and/or ILD [4-6] These alleles form part of a conserved, ancestral Caucasian haplotype ... Ichikawa Y, Moriuchi J, Hoshina Y, Yamada C, Wakabayashi T, Jackson K, Inoko H: HLA class II haplotypes associated with pulmonary interstitial lesions of polymyositis/dermatomyositis in Japanese ... agents capable of inducing lung fibrosis There are methodological issues that require discussion As patient recruitment was multi-centre, disease subtype misclassification of a small number of...
- 9
- 768
- 0
Báo cáo khoa học: " Intensity modulated radiotherapy (IMRT) in the treatment of children and Adolescents - a single institution''''s experience and a review of the literature" pps
... Laskar S, Bahl G, Muckaden M, Pai SK, Gupta T, Banavali S, Arora B, Sharma D, Kurkure PA, Ramadwar M, Viswanathan S, Rangarajan V, Qureshi S, Deshpande DD, Shrivastava SK, Dinshaw KA: Nasopharyngeal ... statistical analysis and writing of the manuscript SN is responsible for the physical aspects of IMRT planning and treatment of the children HB is responsible for the anaesthesia management of ... or inner ears represent an extraordinary challenge in the radiotherapeutic management Starting with the biggest of all central nervous treatments the irradiation of the entire craniospinal axis...
- 10
- 523
- 0
Báo cáo y học: "Do synovial biopsies help to support evidence for involvement of innate immunity in the immunopathology of Behçet’s disease" pot
... Arthritis Research & Therapy Vol 11 No van Laar et al Mucosal tissue is predominantly involved in BD, and microorganisms from the external environment can readily influence observations in inflammatory ... inflammation [14] Cañete’s group has studied SF extensively in various other arthropathies, such as spondyloarthropathy (SpA) and RA, and comparisons may be made with historical data Comparing ... in Behçet disease and psoriatic arthritis Arthritis Res Ther 2009, 11:R17 Sakane T, Takeno M, Suzuki N, Inaba G: Behçet’s disease N Engl J Med 1999, 341:1284-1291 van Laar JA, Missotten T, van...
- 3
- 352
- 0
Báo cáo y học: " Bronchoalveoloar lavage fluid cytokines and chemokines as markers and predictors for the outcome of interstitial lung disease in systemic sclerosis patients" pps
... is an autoimmune disease characterized by fibrosis of the skin and various internal organs Interstitial lung disease (ILD) and its complications represent the most prominent causes of death in ... therapeutic targets of SSc-related lung disease Systemic sclerosis is a rare disease, and most studies analyzing BALF cytokines have included only few patients with SSc Our analysis is one of the largest ... respectively In the control group, 20 patients had alveolitis, and among them, 12 had sarcoidosis, and six patients had idiopathic interstitial lung disease One patient had broncheolitis obliterans and another,...
- 11
- 584
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu