include all size related stylesheets in the page but enable only one at a time
Báo cáo khoa học: Roles of prolactin-releasing peptide and RFamide related peptides in the control of stress and food intake potx
... Proc Natl Acad Sci USA 100, 15247–15252 53 Takayasu S, Sakurai T, Iwasaki S, Teranishi H, Yamanaka A, Williams SC, Iguchi H, Kawasawa YI, Ikeda Y, Sakakibara I et al (2006) A neuropeptide ligand ... intestine in response to meals, and acts via the CCKA receptor on afferent vagal fibers that project into the medulla oblongata, which relays information into the hypothalamus Food intake [13] or the administration ... energy balance AMY, amygdala; ARC, arcuate nucleus; BST, bed nucleus of the stria terminalis; DMH, dorsomedial hypothalamus; LHA, lateral hypothalamic area; NTS, nucleus tractus solitarii (A2 noradrenergic...
- 8
- 489
- 0
Báo cáo khoa hoc:"SRY-related genes in the genome of the rice field eel (Monopterus albus)" docx
... act ct acgcaaacaacagt t aat t at t cact aat ggat gcagt ggt t gt t caggcagcaggt gat gt t at t aaaagt t act gcat ct gggt t acgcat cagat gt aacct caagaat ct gt ccct gt ccccaaaaat ggcaacaagct at t ... G A A TG TG gt t gcct gt gt accagat ct at acaggat at t at t caaccacat t ct t ct at t ccacacagt t t ct gaat t t gaggt gct t ct gt at t t agt t t t aat t cat gt ct agt t gat t t t a t t ct t act ... t t t a a t a t t a a t g a a c a c t t t t c t gt ga t a c t t t c a g ATTGCTCAATGAAGTAGAAAAGCGTCCGTTTGTGGAAGAAGCAGAGC 00 S R L R V Q H K K D GTTTGAGAGTGCAGCATAAGAAGGATCA H, M...
- 9
- 343
- 0
CATHETER-RELATED INFECTIONS IN THE CRITICALLY ILL - PART 1 doc
... 87 Management and Treatment Amar Safdar, M.D and Issam I Raad, M.D 99 Catheter -Related Infections in the Critically Ill vi The Management and Treatment of Intravascular Catheter -Related Infections ... Patients often have limited access, coagulopathies, or other anatomical and clinical considerations that preclude removing the central catheter There are data to support leaving a catheter in ... Hôpital Bichat-Claude Bernard Paris, France This page intentionally left blank Preface Intravascular catheters are an integral part of the daily practice of medicine in the intensive care unit As...
- 19
- 307
- 0
CATHETER-RELATED INFECTIONS IN THE CRITICALLY ILL - PART 2 docx
... circumstances mandate cannulation of an internal jugular or femoral vein rather than a subclavian vein (e.g., severe coagulopathy or a hemodialysis catheter) Catheter Exchange Over a Guidewire The ... skin care and full barrier precautions at catheter insertion were 24 Catheter -Related Infections in the Critically Ill unsuccessful and, at a given point, catheter sepsis due to coagulase-negative ... jugular or femoral vein is associated with a substantially higher risk of catheter -related BSI than insertion in a subclavian vein (RR, 1-3.3) (24,27-31) Femoral line insertion also dramatically and...
- 19
- 312
- 0
CATHETER-RELATED INFECTIONS IN THE CRITICALLY ILL - PART 3 ppsx
... explain why skin -related infections usually develop early after catheterization Extraluminal contamination is uncommon during intravenous feeding since TPN catheters are almost universally inserted ... contamination are starting to be unveiled Atela et al (32) investigated the Antonio Sitges-Serra 33 dynamics of catheter segment contamination by these bacteria using strain delineation and reached ... surrounding the catheter and to facilitate S aureus infections There is no evidence, however, that catheter material has a measurable impact on CRBSI rates in humans The case of the coagulase-negative...
- 19
- 286
- 0
CATHETER-RELATED INFECTIONS IN THE CRITICALLY ILL - PART 4 ppt
... Randolph A, Weinstein RA Guidelines for the prevention of intravascular catheter -related infections Pediatrics 2002; 110(5):e51 Mermel LA Defining intravascular catheter -related infections: a plea for ... colonization of the catheter occur at different times during 60 Catheter -Related Infections in the Critically Ill catheterization (3) Overall, about 65% of CRIs originate from the skin, 30% from the ... in the catheter stains to diagnose infection One group of investigators (15) described a Gram stain technique of catheters that allowed rapid diagnosis of catheter infection Upon removal, catheters...
- 19
- 303
- 0
CATHETER-RELATED INFECTIONS IN THE CRITICALLY ILL - PART 5 ppsx
... differentiate between catheter -related and non-catheter -related bacteremia The subset of patients with catheter -related NBSI was described in a subgroup analysis (12) The attributable mortality from the ... suggesting that extraluminal contamination of introducers occurs early from the skin, whereas Swan Ganz contamination results from endoluminal contamination resulting from repeated handling Gérard ... Catheter -Related Infections in the Critically Ill Patient MORTALITY ASSOCIATED WITH CRI A number of epidemiological studies document a lower mortality associated with primary and catheter-related...
- 19
- 446
- 0
CATHETER-RELATED INFECTIONS IN THE CRITICALLY ILL - PART 6 pptx
... may be associated with either contaminated infusate or catheter hub contamination due to repeat manipulation by medical personal Antimicrobial Therapy Optimum treatment includes early institution ... catheter -related bacteremia while others have maintained that the risk of late complications and relapse makes this approach unacceptable unless a transesophageal echocardiogram is negative and the patient ... appropriate therapy be instituted early, especially in severely ill patients with infected intravascular device -related bacteremia or fungemia Amar Safdar and Issam I Raad 105 agglomerans group may...
- 19
- 284
- 0
CATHETER-RELATED INFECTIONS IN THE CRITICALLY ILL - PART 7 doc
... determine the duration of therapy for intravascular catheterassociated Staphylococcus aureus bacteremia Ann Intern Med 1999; 130: 810–820 Raad I Optimal duration of therapy for catheter -related Staphylococcus ... includes inflammation such as erythema and/or exudate at the catheter insertion site 114 Catheter -Related Infections in the Critically Ill There may be no obvious source of infection in a patient ... successfully treat device related infections, antimicrobials alone are being used in an attempt to salvage catheters particularly in patients with mild or moderate associated sepsis However, if the patient...
- 19
- 332
- 0
CATHETER-RELATED INFECTIONS IN THE CRITICALLY ILL - PART 8 ppt
... evaluate the 140 Catheter -Related Infections in the Critically Ill available studies that have investigated whether education is an effective intervention for preventing vascular catheter infection ... Catheter -Related Infections in the Critically Ill Capdevila JA, Segarra A, Planes A Long term follow-up of patients with catheter related sepsis (CRS) treated without catheter removal [abstract ... No change was noted in catheter hub or catheter tip colonization In the second study, Cohran et al examined the impact of an intravascular surveillance and education program on catheter-related...
- 19
- 275
- 0
CATHETER-RELATED INFECTIONS IN THE CRITICALLY ILL - PART 10 ppt
... infusate -related infection and, 35–36 rates of infection with, 12 Pathogenesis, catheter -related infection, 6, 59–60, 161 Patient population, critically ill, catheter -related infection in diagnosis, ... antimicrobial therapy, 105–106 Candida tropicalis, 105 Cardiac output, educational information on, 132 Catheter characteristics, rates of infection according to, 12 Catheter colonization, defined, Catheter ... sulfadiazine impregnated catheters (33) The beneficial effect began after day of catheterization None of the catheters were evaluated beyond 30 days No minocycline/rifampin-resistant organisms...
- 16
- 342
- 0
Báo cáo y học: " Species and age related differences in the type and distribution of influenza virus receptors in different tissues of chickens, ducks and turkeys" pps
... 80 +++ MAA %a Intb 1-day Kidney Small intestine Large intestine Bronchi Trachea Tissues Table The distribution and intensity of a2 ,6SA-gal (stained by MAA) and a2 ,3SA-gal (stained by SNA) receptors ... Vascellari M, Granato A, Trevisan L, Basilicata L, Toffan A, Milani A, Mutinelli F: Pathologic findings of highly pathogenic avian influenza virus A/ Duck/Vietnam/12/05 (H5N1) in experimentally infected ... both avian and human type receptors along the esophageal mucosa indicating that influenza viruses can attach and possibly replicate in the upper digestive tract which is an important portal of...
- 8
- 257
- 0
Báo cáo y học: "Prevention of central venous catheter-related infection in the intensive care unit" ppt
... Page of Type of catheter Catheter material is an important determinant in the prevention of catheter -related infection The material should be biocompatible, hemocompatible, biostable, chemically ... bacteria in skin samples at catheter removal and was well tolerated The authors concluded that the use of chlorhexidine gluconate-impregnated sponge dressings with intravascular catheters in the ... [50–52] The most important include the use of a checklist to guide catheter insertion and maintenance; adequate training of the nursing staff involved in the management of vascular access and an adequate...
- 8
- 397
- 0
Báo cáo y học: " Elevation of cardiac troponin I during non-exertional heat-related illnesses in the context of a heatwave" doc
... biological data YLM participated in statistical analysis BR participated in the conception and design of the study, statistical analysis and interpretation of data, and in drafting the manuscript Acknowledgements ... pointed out that a high heart rate indicates a considerable heart strain in the clinical conditions of heatstroke and that an elevated serum creatinine level might reflect global dehydration The ... cTnI and calculated their odds ratio and 95% confidence interval To avoid overfitting, we used a conservative approach and included only the significant variables in the univariate Hausfater et al...
- 9
- 298
- 0
Báo cáo y học: " The evaluation of Pat-Pat related injuries in the western black sea region of Turkey" ppsx
... its coordination MU has given assistance to analyzing the data BK and TD have contributed in collecting the data and literature search All authors read and approved the final manuscript Page of ... such as Duzce, Kocaeli and Sakarya, and named as “Pat-Pat” This name originates from the sound made by this machine This vehicle has two separate structures; the main part is an engine and the other ... this article as: Karapolat et al.: The evaluation of Pat-Pat related injuries in the western black sea region of Turkey Scandinavian Journal of Trauma, Resuscitation and Emergency Medicine 2011...
- 6
- 272
- 0
studies of pathogenesis-related proteins in the strawberry plant partial purification of a chitinase-containing protein complex and analysis of an osmotin-like protein gene
... infection caused by the bacteria and therefore to regulate nodulation (Vasse et al., 1993) A class III chitinase from Sesbania rostrata was induced in the early stage of nodulation and accumulated around ... thaumatinlike proteins (TLPs) In addition, osmotin, which was originally identified as the predominant protein in salt-adapted tobacco cells, is related to thaumatin in amino acid sequence and therefore ... organism (Ponath et al., 2000) A class III chitinase in Vitis vinifera was first induced in the leaf inoculated with Plasmopara viticola, and induced later in the upper-stage healthy leaf; in...
- 119
- 307
- 0
Organizing pairwork and groupwork in the context of high school classrooms at pham van nghi upper secondary school, nam dinh province: A case study
... theories related to the study : Communicative approach to language teaching, and pairwork and groupwork in language teaching and learning 1.1 Communicative approach to language teaching 1.1.1 What ... link up with individuals and organizations at regional, national and international levels Increasingly sophisticated technology enables us to achieve a scope and range of communication unimaginable ... teaching grammar, reading, writing, vocabulary and listening ; for teaching grammar, for teaching reading, for teaching writing, and only for teaching vocabulary, and for teaching listening Each...
- 62
- 1,349
- 6
Some aspects of American culture and society in the twentieth and twenty-first centuries through a number of selected short literary works
... black or African-American, American Indian or Alaska native, Asian, native Hawaiian, other Pacific Islander and ethnic groups due to immigrations from all around the world However, when all these ... people, animals or anything that the writer chooses to act in the story The main character is called the protagonist and the other characters that support the conflict of the story are the antagonists ... Pennsylvania about this informal practice, they said that this is typical of the American to serve their guests at home in such an informal way In addition, in the book American Ways, an example of an...
- 49
- 785
- 1
An analysis of the inaugural address by g w bush in the u s president election 2004 from a perspective of discoure analysis
... behind the attacks) and many of his top aides were in vain In March 2003, the U S-led coalition attacked Iraq reasoning that Iraq was storing weapons of mass destruction and maintaining the alleged ... situational ones In 1976, Halliday and Hasan state that: Linguistically, he responds to specific features which bind the passage together, the pattern of connection, independent of structure, that ... underlying assumptions in the speech All the interpretation and conclusion are drawn from description of data and generalization of the findings in the previous sections Intonation, posture and all...
- 44
- 578
- 0
An investigation into group work activities in the 10th graders' english speaking classes at quy hop II high school in nghe an province
... Le Van Canh (2004) claims that the changes in the second language teaching in general and the changes in English language teaching in particular are not the changes in the way we teach These are ... teaching In Nunan’s theory, the ability to operate in a second language can be actually equated to the ability to speak that language Many language learners consider speaking ability the measure ... (1987) states that oral communication must include speaking and listening It means that there at least two participants: speakers and listeners in a conversation From the aforementioned nature...
- 110
- 1,087
- 6
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25