in which groups of children with a uri should routine surgery definitely be canceled
Báo cáo y học: " A modelled economic evaluation comparing atomoxetine with methylphenidate in the treatment of children with attention-deficit/hyperactivity disorder in Spain" pot
... applicable a Probabilities of response in stimulant-naïve patients are not contra-indicated are based on a meta-regression analysis [45] of response data from randomised active comparator trials of atomoxetine ... translated into QALY gains for patients treated with atomoxetine For the stimulant-naïve patients without contra-indications to stimulants (population 1), treatment with atomoxetine was associated ... values of 0.880 The additional QALYs gained associated with atomoxetine treatment was 0.039 and 0.042 in population and 3, respectively The incremental cost per QALY gained associated with atomoxetine...
- 13
- 528
- 0
Báo cáo y học: "CXCR3/CXCL10 expression in the synovium of children with juvenile idiopathic arthritis" pot
... experiments Statistical analysis Data were analyzed with the assistance of the Statistical Analysis System Data are expressed as means ± standard deviation Mean values were compared using the ANOVA test ... synovium of a patient with juvenile idiopathic arthritis Note the marked staining of inflammatory cell infiltrate in the perivasarthritis cular area [original magnification ×50 (a) , ×100 (b)] Negative ... expression in the synovium of a patient with juvenile idiopathic arthritis Few inflammatory cells showing moderate staining; original arthritis magnification ×50 (a) , ×100 (b) Negative staining in control...
- 9
- 449
- 0
Báo cáo y học: "Improvements in the outcome of children with meningococcal disease" pptx
... incorporate this vaccine into a national immunisation programme Following this, disease attack rates dropped in the vaccinated, carriage rates dropped and the incidence declined among unvaccinated ... following a primary care assessment [12] Strategies to increase awareness in primary care have targeted the recognition of presenting clinical features and the administration of penicillin to children ... as leukaemia, an improvement in overall mortality inevitably leads to greater focus on the quality of life of survivors with survival being at minimum cost rather than at any cost Page of (page...
- 2
- 218
- 0
Báo cáo y học: "Correlates of self-reported offending in children with a first police contact from distinct sociodemographic and ethnic groups" pot
... level of offending among children who have already committed an offense Focusing on offending in younger children, defined as committing a first offense before puberty, may bear specific relevance, ... number of variables, only variables that correlated with the dependent at a significance level of p < 10 were included In addition, in case of the SDQ scales that were measured both in parents and ... control scale low (a =.48) Statistical analyses For statistical analysis, SPSS 13.0 was used First, variables were described using means for continuous and percentages for categorical variables Inter-group...
- 12
- 337
- 0
báo cáo hóa học: " A psychometric evaluation of the PedsQL™ Family Impact Module in parents of children with sickle cell disease" pptx
... is an urban based clinic that provides primary care to over 4,000 children a year The majority of patients who regularly attend this clinic are African American (80%) and have public insurance ... United States Census classification and reflect parent report based on the following choices: White, Black, Native Hawaiian or Other Pacific Islander, Asian, American Indian or Alaskan native, ... measure the impact of a chronic health condition on parents and families It has been shown to be reliable and valid in smaller studies of children with complex special health care needs and children...
- 11
- 552
- 0
Báo cáo y học: "Prediction of posttraumatic stress in fathers of children with chronic diseases or unintentional injuries: a six-months follow-up study" pps
... status was calculated by means of a score reflecting paternal occupation and maternal education (range 2–12 points) using a measure that has been shown to be a reliable and valid indicator of ... verbal descriptors for each level A factor analysis of the seven original appraisal items extracted three factors with appraisal of threat and appraisal of distress loading on the same factor ... associated with coping in fathers of children with different chronic diseases, indicating that fathers relying on strategies such as avoidance coping [25], behavioral disengagement, or venting of...
- 10
- 252
- 0
Diarrhea is a Major killer of Children with Severe Acute Malnutrition Admitted to Inpatient Setup in Lusaka, Zambia
... grouped as categorical data for purposes of analysis During the analysis, a variable called “nutstat” was created based on a combination of children s admission edema and WHZ Accordingly, children ... Diarrhea is a Major killer of Children with Severe Acute Malnutrition Admitted to Inpatient Set-up in Lusaka, Zambia Abel H Irena‡¹, Mwate Mwambazi², Veronica Mulenga² ¹Valid International, ... Mortality of children with Severe Acute Malnutrition (SAM) in inpatient set-ups in sub-Saharan Africa still remains unacceptably high We investigated the prevalence and effect of diarrhea and HIV infection...
- 19
- 324
- 0
Parenting Stress in Mothers of Children with Congenital Heart Disease pptx
... collection Approval of the institutional review board of the hospital was obtained prior to collecting data A research assistant was familiarized with the goal of this study, the diagnosis of CHD, and ... planning and carrying out of care for the child Lack of clarity refers to receiving or perceiving information about the child’s treatment and the system of care as intricate and ill-defined Lack ... Parenting Stress in Mothers of Children with CHD and anxiety of children with CHD were related more to maternal anxiety and pampering than to the degree of incapacity or severity of disease...
- 9
- 677
- 0
Đề tài " The distribution of integers with a divisor in a given interval " ppt
... 2, 3, and in Section The first step in all estimations is to relate the average behavior of τ (n, y, z), which contains local information about the divisors of n, with average behavior of functions ... conversations about the paper Much of this paper was written while the author enjoyed the hospitality of the Institute of Mathematics and Informatics, Bulgarian Academy of Sciences Finally, the author ... The author also thanks G´rald Tenenbaum for several preprints of his work and for informe ing the author about the theorem of Rogers mentioned above, and thanks INTEGERS WITH A DIVISOR IN AN INTERVAL...
- 68
- 409
- 0
Báo cáo Y học: Solution structure of the Alzheimer amyloid b-peptide (1–42) in an apolar microenvironment Similarity with a virus fusion domain potx
... HFIP has been chosen as a result of a vast exploratory search because it can dissolve Ab-(1–42) better than all other media and, at the same time, it has a helix-promoting ability very similar to ... loaded with Na-Fmoc-Ala (Fmoc-Ala-PAC-PEG-PS) was from Millipore (Waltham, MA, USA) Fmoc-Ala-PACPEG-PS resin (0.15 mmolÆg)1, g) was treated with piperidine (20%) in dimethylformamide and linked ... HFIP is a polar molecule, it can solvate apolar surfaces with its strongly hydrophobic side chains; this feature has been aptly described by Rajan et al as a Teflon coating that can surround a helix...
- 7
- 624
- 0
Báo cáo sinh học: " Unusual presentation of hepatitis B serological markers in an Amerindian community of Venezuela with a majority of occult cases" doc
... Loureiro,Aff2 Email: cloureir@gmail.com Domingo J Garzaro,Aff2 Email: dgarzaro@gmail.com Mar a C Duarte,Aff1 Email: mcarolad@hotmail.com Daisy M Garc a, Aff1 Email: mayilag@hotmail.com Milian C Pacheco,Aff1 ... isolate, BP21, exhibited co-circulation of a wild type virus along with a variant harboring a premature stop codon at aa 42 of the core protein, and a variant exhibiting a deletion of 28 aas (aa ... circulating in other Amerindians populations were included, from the Orinoco Delta (DELTA), in Yucpas (JAPREIRA) and in Yanomamis (Y) and Piaroas (P) from the Amazon (AMAZ) Figure HBV core variants...
- 13
- 375
- 0
báo cáo hóa học: " A decision support framework for the discrimination of children with controlled epilepsy based on EEG analysis" pdf
... to are used as biomarkers in the bivariate case and are calculated for each brain region (lobe) assuming again a preselected lobe scheme that contain grouped channel pairs instead of single channels ... identifying significant spectral differences within the frontal left lobes of Alpha and Gamma2 band and central lobes of the Alpha band Alterations in the Alpha band are also expected since they are ... Alpha bands, as well as a symmetrical energy variation pattern in Delta, Theta, Alpha and Beta bands This result is in line with earlier studies [19,30], which found an increase in deltatheta...
- 14
- 454
- 0
Báo cáo hóa học: " The happiness of people with a mental disorder in modern society" pdf
... Haro, JM, Kawakami, N, Karam, A, Levinson, D, Medina Mora, ME, Oakley Brown, MA, Posada-Villa, J, Stein, DJ, Adley Tsang, CH, Aguilar-Gaxiola, S, Alonso, J, Lee, S, Heeringa, S, Pennell, BE, Berglund, ... detail about the various mental disorders involved A first point is that people diagnosed as abusing alcohol are as happy as people without any mental disorder This may be explained by the finding ... their happiness However, the data not support this explanation Happiness of people with and without mental disorders turn out to be associated in the same way with other indicators of wellbeing...
- 6
- 340
- 0
Báo cáo toán học: "On the number of subsequences with a given sum in a finite abelian grou" pptx
... exactly r minimal zero-sum subsequences, which is a contradiction This proves Claim A Choose a term c in T1 but not in T2 By Claim A, we have that c is in another Ti , say Tr+2 and so not in any ... and Q.H Wang, A quantitative aspect of non-unique factorizations: the Narkiewicz constants, International Journal of Number Theory, to appear [13] W.D Gao and J.T Peng, On the number of zero-sum ... Narkiewicz, Finite abelian groups and factorization problems, Colloq Math 42 (1979), 319–330 ´ [22] W Narkiewicz and J Sliwa, Finite abelian groups and factorization problems II, Colloq Math 46 (1982),...
- 10
- 360
- 0
Báo cáo y học: "A 64-week, multicenter, open-label study of aripiprazole effectiveness in the management of patients with schizophrenia or schizoaffective disorder in a general psychiatric outpatient setting" pptx
... Hyperprolactinemia, which is associated with some antipsychotic treatments, has a number of potential adverse clinical consequences, such as galactorrhea and gynecomastia, or endocrine-related secondary ... Hualien, Taiwan National Cheng Kung University Hospital, Tainan, Taiwan 6National Taiwan University Hospital, Yun-Lin Branch, Yun-Lin, Taiwan 7Changhua Christian Hospital, Lu-Tung Branch, Changhua, ... positive and negative symptoms of schizophrenia and are also associated with a lower incidence of extrapyramidal symptoms and hyperprolactinaemia, both side effects that are commonly associated with...
- 9
- 748
- 0
Báo cáo y học: "A novel approach to measure the contribution of matrix metalloproteinase in the overall net proteolytic activity present in synovial fluids of patients with arthritis" pptx
... Yoshihara Y, Nakamura H, Obata K, Yamada H, Hayakawa T, Fujikawa K, Okada Y: Matrix metalloproteinases and tissue inhibitors of metalloproteinases in synovial fluids from patients with rheumatoid arthritis ... secretion of members of the MMP family is the hallmark of several inflammatory disorders, including arthritis MMP-9, in particular, has been implicated in the degradation and damage of articular cartilage ... Momohara S, Kashiwazaki S, Inoue K, Saito S, Nakagawa T: Elastase from polymorphonuclear leukocyte in articular cartilage and synovial fluids of patients with rheumatoid arthritis Clin Rheumatol...
- 10
- 494
- 0
Báo cáo khoa học: " Intensity modulated radiotherapy (IMRT) in the treatment of children and Adolescents - a single institution''''s experience and a review of the literature" pps
... Muckaden M, Pai SK, Gupta T, Banavali S, Arora B, Sharma D, Kurkure PA, Ramadwar M, Viswanathan S, Rangarajan V, Qureshi S, Deshpande DD, Shrivastava SK, Dinshaw KA: Nasopharyngeal Carcinoma in Children: ... years ago as part of multimodality treatment of an acute lymphoblastic leukaemia About four years later he presented with an anaplastic astrocytoma and therefore received external beam radiation ... similar approach by the groups of Atlanta (20 children) and Houston (19 children) headand-neck rhabdomyosarcomas could be treated with a year local control of 100% and a four year local control of...
- 10
- 523
- 0
Báo cáo y học: "DREAM is reduced in synovial fibroblasts of patients with chronic arthritic pain: is it a suitable target for peripheral pain management" pptx
... 5'-AAGTGGGCCTTTAATCTCTACTATAGTGAGTCGTATTA-3' siRNA4 5'-AAGCTCATGATGTTCTCATCCTATAGTGAGTCGTATTA-3' 5'-AAGGATGAGAACATCATGAGCTATAGTGAGTCGTATTA-3' siRNA5 5'-AAGTGTAGCAATCTGTTCACTATAGTGAGTCGTATTA-3' 5'-AAGTGAACAGATTGCTACACTATAGTGAGTCGTATTA-3' ... 5'AAGGTCAAGTGGATCCTGTCCTATAGTGAGTCGTATTA3' siRNA2 5'-AAGGTGAACTTGGTCTGGGCCTATAGTGAGTCGTATTA3' 5'-AAGGCCCAGACCAAGTTCACCTATAGTGAGTCGTATTA-3' siRNA3 5'-AAGTAGAGATTAAAGGCCCACTATAGTGAGTCGTATTA-3' 5'-AAGTGGGCCTTTAATCTCTACTATAGTGAGTCGTATTA-3' ... 5'-TAAATGAGTTTGAAGGTGTC-3' 5'-ACAGGAACCCTCTAGGGAAGA-3' Oligonucleotides for the synthesis of siRNAs Sense Antisense siRNA1 5'-AAGGACAGGATCCACTTGACCTATAGTGAGTCGTATTA-3' 5'AAGGTCAAGTGGATCCTGTCCTATAGTGAGTCGTATTA3'...
- 8
- 576
- 0
Báo cáo y học: "An MRI study on the relations between muscle atrophy, shoulder function and glenohumeral deformity in shoulders of children with obstetric brachial plexus injury" ppt
... outlined and of affected shoulder with area of measurement of subscapularis muscles Transversal MR imageshowing Centricity 600 results of area Transversal MR image of affected shoulder with area of ... Figure mal acquisition MRI in axial FISPcontralateral shoulder plane showing affected and norFISP acquisition MRI in axial plane showing affected and normal contralateral shoulder In the affected ... with increasing infra- and subscapularis atrophy as described by Pöyhiä et al Because of this muscle's position and the great inter-individual variation in the shape of its different heads, measuring...
- 8
- 433
- 1
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008