immunological adverse reaction associated with low carbide content metal on metal bearings in a contemporary cementless total hip arthroplasty
Overwintering Survival of Strawberry (Fragaria x ananassa): Proteins Associated with Low Temperature Stress Tolerance during Cold Acclimation in Cultivars
... Fragaria vesca F x ananassa Fragaria vesca Fragaria vesca Fragaria vesca Fragaria vesca F x ananassa Fragaria vesca F x ananassa F x ananassa F x ananassa Prunus dulcis Malus x domestica Malus ... Malus x domestica 2809 4165550 Species Fragaria vesca Fragaria vesca Malus x domestica Fragaria vesca Fragaria vesca Fragaria vesca Fragaria vesca F x ananassa F x ananassa Fragaria vesca Fragaria ... Protein Confidence Values Listed as q-values To build the Fragaria protein database, the Fragaria × ananassa and Fragaria vesca protein fasta database and EST sequence databases for taxonomy...
- 140
- 145
- 0
Factors associated with low educational motivation among ethnic minority students in Vietnam
... paper explores the factors influencing educational motivation and thereby preventing ethnic minority students in Lam Dong Province from gaining higher educational attainments Methodology A qualitative ... engagement in educational activities Ogbu’s theory on strong ethnic identity and educational attainments claims that ethnic minorities may have oppositional attitudes towards what is considered as belonging ... system and the society 132 Factors associated with low educational motivation among ethnic minority students in Vietnam Conclusion The research findings showed that numerous factors had an influence...
- 13
- 357
- 0
Báo cáo y học: "Intramuscular myxoma associated with an increased carbohydrate antigen 19.9 level in a woman: a case report" pptx
... was lobulate with dimensions 78×59×45 mm and relatively well-defined margins No enhancement was marked after the intravenous administration of paramagnetic substance (Figures and 2) Additional ... dysplasia of the bones of the same extremity, known as Mazabraud syndrome [6,7] The vast majority of patients are asymptomatic, and the myxoma appears as a painless, slowly enlarging, palpable, ... well-defined margins IM usually does not appear capsulated, but sometimes it can have a partial or complete capsule [4] Before the administration of intravenous contrast, CT reveals a mass of low attenuation...
- 4
- 385
- 0
báo cáo hóa học:" Women''''s quality of life is decreased by acute cystitis and antibiotic adverse effects associated with treatment" pptx
... clinical condition of the patient, as well as drug allergies, rate of adverse reactions and cost of treatment In many settings, particularly health maintenance organizations, treatment algorithms ... for all patient at each follow up contact Quality of Life for all patient at each follow up contact Days after enrollment mean QWB cure mean QWB fail Figure up contact Quality of Life in patients ... groups at baseline and 28 days This indicates all patients were experiencing significant decreases in QOL at baseline It also indicates we are able to measure the impact of cystitis on QOL The fact...
- 7
- 459
- 0
Báo cáo y học: "Exome sequencing identifies a missense mutation in Isl1 associated with low penetrance otitis media in dearisch mice" pptx
... CAGGCATAAAAGATGGTGTCTCTAAG CTATATGTACAGAGGGACCAGTCTTGG GACCAAACCAACAGCAATTGTAAAC Creb3l2 6:37284584 GATGCCCTGAGCAGAGAGG TGCAGAAAGCCAAACCTAGC Gm10859 2:5833494 AATCTCAGTTGAGAGAAAACCTACG GAGATAGCTCAGTCAGTCAGTCAGG ... GACACTAAAAGTAGAAAGCAGTCACC GCTTTTCTAGCTTTACAATGACTGG Sap30bp 11:115825338 CAACACAGGAAATGGACACG AACCAACAGGACCCAGAGG U1 1:172958261 TAAATACTTACCTGGCAGGAGAGATACC TTATATTGGTGCACTAGCTTCATGC Hilton ... GGACAAAGAATAACACAGATTTTCC GAACAAAGGAATGAAGAAGAGG Olfr573-ps1 7:110091057-8 AGAGGAAGTAGTACATAGGCTCATGG CTACTGAAAGAGTTAACTTAGTGGAGAGG Olfr749 14:51356853 AGACAGAATGTTGGCTAGTATGTTAGG CTAATTATCTAGATCGCCTTTGACTCC...
- 19
- 319
- 0
báo cáo khoa học: "Methadone adverse reaction presenting with large increase in plasma methadone binding: a case series" pdf
... half-life calculated from the terminal elimination phase Estimated using an extrapolation method based on the terminal elimination phase AUC = area under the plasma concentration time curve; AUC0-12 ... cannot explain the increase in plasma binding actually observed In contrast, we observed a decrease in fu due to increased plasma binding of methadone and its metabolites A 3.7-fold change in ... addition, we observed an increase in plasma protein concentrations, and this is consistent with the increase in plasma methadone binding Of note, increased plasma protein concentration has been previously...
- 7
- 349
- 0
Báo cáo y học: " Sarcoid reaction associated with Merkel cell carcinoma revealed by fluorodeoxyglucose positron emission tomography: a case report" ppt
... inguinal mass and the absence of tumor cells in the mediastinal lymph node led to a diagnosis of Merkel cell carcinoma arising in the inguinal region Her sarcoid reaction was mediastinal Although sarcoid ... areas of FDG accumulation in the mediastinum and left inguinal region Figure Photomicrograph showing the pathological findings of non-caseating epithelioid cell granulomas with giant cells (arrow) ... cytoplasm and regular nuclei with dusty chromatin No nucleoli are visible (hematoxylin and eosin stain; original magnification, ×400) metastasized to the superficial inguinal lymph node Pathological...
- 3
- 298
- 0
Báo cáo khoa hoc:" Anaphylactic reaction associated with Ranitidine in a patient with acute pancreatitis: a case report" pdf
... reaction Conclusion This case report was prepared to highlight a rare and unusual adverse reaction to a widely used drug, ranitidine Caution needs to be exercised on intravenous administration ... Hewitt PB: Anaphylactoid reaction to ranitidine in an obstetric patient Anaesthesia 1992, 47(4):360-1 Greer IA, Fellows K: Anaphylactoid reaction to ranitidine in labour Br J Clin Pract 1990, ... not find any association between allergies to metronidazole and buscopan and the development of an anaphylactic reaction to ranitidine Consent was obtained from the patient for publication of...
- 2
- 318
- 0
Báo cáo y học: "Antibodies toward infliximab are associated with low infliximab concentration at treatment initiation and poor infliximab maintenance in rheumatic diseases" potx
... maintenance of infliximab Among ATIpos patients, 11 (52%) had at least one infusion-related reaction, as compared with only (1%) in the ATIneg group The median interval between ATI detection and infusion-related ... during infliximab initiation for ATIpos and ATIneg patients with RA and SpAa RA (n = 17) SpA (n = 91) Time after infliximab initiation ATIpos (n = 7) ATIneg (n = 10) P value ATIpos (n = 14) ATIneg ... Antibodies toward infliximab are associated with low infliximab concentration at treatment initiation and poor infliximab maintenance in rheumatic diseases Arthritis Research & Therapy 2011 13:R105...
- 7
- 505
- 0
Báo cáo y học: "High systemic levels of interleukin-10, interleukin22 and C-reactive protein in Indian patients are associated with low in vitro replication of HIV-1 subtype C viruses" docx
... HIV-1 infections worldwide in 2004 [1] It predominates in countries with 80% of all global HIV-1 infections (subSaharan Africa, India) and is rapidly increasing in China and Latin America [2-5] ... statistical analyses and contributed to the interpretation of the data and drafting of the paper MB assisted in patient and data collection and contributed to virus isolation and replication kinetics ... SIV infection in African green monkeys are associated with protection against AIDS J Clin Invest 2005, 115:1082-1091 Dunham R, Pagliardini P, Gordon S, Sumpter B, Engram J, Moanna A, Paiardini...
- 15
- 258
- 0
Báo cáo y học: " Increased APOBEC3G and APOBEC3F expression is associated with low viral load and prolonged survival in simian immunodeficiency virus infected rhesus monkeys" ppt
... Page 12 of 17 mechanisms may also potentially become activated in uninfected individuals as various vaccination regimens can induce a long lasting upregulation of A3 G in macaques [22,65] In addition, ... SIV-infected macaques Plasma viral loads as well as A3 G and MxA mRNA levels in PBMC were determined longitudinally in seven macaques before and after inoculation with SIV (left panels A- C) Viral ... these intrinsic antiretroviral factors for anti-HIV therapy and vaccination Materials and methods Animals Rhesus macaques (Macaca mulatta) of Indian origin were housed at the German Primate Centre...
- 17
- 242
- 0
analysis of data on spontaneous reports of adverse events associated with drugs
... as practicable Some adverse drug reactions are not easy to detect after marketing approval because of inaccurate reporting of adverse events and lack of information regarding the population of ... warning messages on packages and information leaflets, labeling modification; limiting indications, mandatory monitoring of patients, dose modification; and limiting distribution and prescription of product, ... experienced a serious adverse drug reaction while on admission for reasons other than ADRs and over 100 000 cases of adverse drug reactions resulted in death in the same year, "making [ADRs one of...
- 206
- 392
- 0
Báo cáo y học: "Clinical Symptoms Associated with Asystolic or Bradycardic Responses on Implantable Loop Recorder Monitoring in Patients with Recurrent Syncope"
... pattern of multifocal chorioretinitis can help establish an early diagnosis of the disease while serologic testing is pending Therefore, an ocular examination, including ophthalmoscopy and FA ... of an emerging epidemic in the United States Annu Rev Med 2006;57:181-94 Khairallah M, Ben Yahia S, Ladjimi A, et al Chorioretinal involvement in patients with West Nile virus infection Ophthalmology ... research phase In conclusion, chorioretinal involvement, frequently asymptomatic and self-limited, is present in almost 80% of patients with WNV infection associated with neurologic disease The...
- 2
- 477
- 0
Báo cáo y học: "Clinical Symptoms Associated with Asystolic or Bradycardic Responses on Implantable Loop Recorder Monitoring in Patients with Recurrent Syncope"
... The continuous data was presented as mean ±SD and categorical data as percentages T-test for comparison of means and chi-square test for categorical data was used Significance was achieved with ... The average duration of monitoring with an ILR was months The baseline clinical characteristics of patients with asystolic or bradycardic responses during ILR monitoring (Group 1) are compared with ... syncope One patent with tachycardia in Group had Ventricular Tachycardia (HR > 140) and episodes of atrial fibrillation (HR 180) Two patients had atrioventricular re-entrant tachycardia with HR...
- 5
- 647
- 0
Tài liệu Báo cáo khoa học: Down-regulation of heme oxygenase-2 is associated with the increased expression of heme oxygenase-1 in human cell lines docx
... 5¢-AGGACUUCUUGAAAGGCAA CAUUAAAG-3¢, antisense, 3¢-UAUCCUGAAGAACUU UCCGUUGUAAUU-5¢; scrambled HO-2 siRNA: sense, 5¢-UAUAAGAGUCAGUACACAUCAUGGAAG-3¢, antisense, 3¢-UAAUAUUCUCAGUCAUGUGUAGUACCU-5¢ Another HO-2-specific ... Lipofectamine 2000 transfection reagent alone were included as a control siGAPDH was also used as a control for transfection with siRNA Other methods are same as in Fig (A and C) Northern blot analysis ... analysis of HO-1 and HO-2 mRNA in HeLa (A) and HepG2 cells (C) Each lane contains 15 lg total RNA The expression of 18S rRNA is also shown as an internal control The data presented are from one...
- 14
- 487
- 0
báo cáo hóa học:" Patient and surgery related factors associated with fatigue type polyethylene wear on 49 PCA and DURACON retrievals at autopsy and revision" pptx
... ± 3°) and patella lateralization on the axial view In a similar way an index of postoperative instability was calculated according to clinical follow up data The amount of translation in antero-posterior ... stratification of these values was similar to that in walking capacity indicated no pain and no satisfaction, whereas indicated most intensive pain and best satisfaction Surgery related factors ... level and patella replacement Separate analysis was done for total wear score as well as medial and lateral compartment wear scores Also partial wear score for fatigue type wear (delamination,...
- 10
- 396
- 0
báo cáo hóa học:" Struma ovarii associated with pseudo-Meigs’ syndrome and elevated serum CA 125: a case report and review of the literature" pdf
... Struma ovarii is a monodermal variant of ovarian teratoma, which predominantly Page of contains thyroid tissue (greater than 50%) and was first described by Von Klden in 1895 and Gottschalk in ... [2] It constitutes about 2.7% of ovarian teratomas It is usually a benign condition although occasionally, malignant transformation is observed Preoperative clinical diagnosis of struma ovarii, ... hysterectomy and bilateral Salpingooophorectomy total abdominal hysterectomy with bilateral Salphingoopherectomy and partial omentectomy Well, months Present case 46 Abdominal swelling, fatigue, weight...
- 4
- 540
- 0
Báo cáo lâm nghiệp: " Crown architecture and leaf habit are associated with intrinsically different light-harvesting efficiencies in Quercus seedlings from contrasting environments" ppt
... Mediterranean oaks (Fig 3) The reduction in the mean area of individual leaves resulted in a non-linear increase in the total number of leaves of the plant (Fig 2) This combination of decreasing leaf ... hot and dry environments These traits have been considered as adaptations to reduce transpiration [31, 37–39] In agreement with this, we observed the lowest mean and total leaf areas in seedlings ... effective strategy for maximizing light capture and carbon gain along the growth season [19] Synchronous leaf expansion minimizes self-shading, which in turn allows for a near-optimal photosynthetic...
- 8
- 434
- 0
Báo cáo khoa học: "Mycorrhization helper bacteria associated with the Douglas fir-Laccaria laccata symbiosis: effects in aseptic and in glasshouse conditions" potx
... β-galactosidase (Onpg); utilization as carbon sources of glucose (Glu), arabinose (Ara); mannose (Mne), mannitol (Man), N-acetyl-glucosamine (Nag), maltose (Mal), gluconate (GNT), caprate ... Laccaria laccata, when inoculated in planting stocks its life cycle In this paper, a range of bacterial isolates from L laccata mycorrhizas and sporocarps have been tested for their effect on ... The treatments without L laccata inoculation were contaminated by T terrestris (ectomycorrhizal basidiomycete), a natural contaminant in the glasshouse (air-borne basidiospores) which had not...
- 13
- 385
- 0
Báo cáo y học: "Heel raises versus prefabricated orthoses in the treatment of posterior heel pain associated with calcaneal apophysitis (Sever’s Disease): study protocol for a randomised controlled trial" ppt
... authors have attempt to mitigate this concern by having the randomisation kept in a secure location Primary and secondary outcome measurements will be undertaken at initial presentation and at one, ... Health, Cranbourne, Australia 2Peninsula Community Health Service - Frankston, Peninsula Health, Frankston, Australia 3Allied Health Clinical Research Unit, Southern Health, Cheltenham, Australia ... the Faces pain scale [37,38] and the Lunge Test [38] The Faces pain scale is a seven point verbal rating scale that will be used to measure severity of pain at rest, on palpation, during activity...
- 7
- 516
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008