immune and clinical correlates of psychological stress induced production of interferon g and interleukin 10 in humans
Báo cáo y học: " Psychiatric disorders and clinical correlates of suicidal " pot
... jumping from a height and attempting traffic death, were individually inquired in the first stage of assessment The next stage was asking the period and the frequency of their occurrence in the ... al in the report of the 2004-2006 Japanese Ministry of Health, Labor and Welfare supported research The types of SB such as self-cutting, overdosing or self-poisoning, self-strangulation, jumping ... of the attempt, and scales of Items 19 Hayashi et al BMC Psychiatry 2 010, 10: 109 http://www.biomedcentral.com/1471-244X /10/ 109 and 20 were used to rate the ingestion of alcohol and other drugs...
- 8
- 371
- 0
báo cáo hóa học:" Trends in the clinical characteristics of HIVinfected patients initiating antiretroviral therapy in Kenya, Uganda and Tanzania between 2002 and 2009" pdf
... economic and social dimensions of life in Africa by increasing labour capacity [4], maintaining educators [5], increasing survival of children [6] and even raising educational attainment among children ... decreasing fraction of new patients accessing ART in Kenya, dropping from 41% in 2002-03 to 34% in 2008-09 (p < 0.01), but the fraction of men accessing care in Uganda and Tanzania did not change ... after taking into account changing trends in sex of patients starting ART over time Third, the fraction of patients who had longer travelling times to a clinic declined by 50% in the programme...
- 10
- 392
- 0
Báo cáo y học: "Critical role of the major histocompatibility complex and IL-10 in matrilin-1-induced relapsing polychondritis in mice" doc
... backcrossed into B10.Q (H2q) mice (originally from J Klein, University of Tübingen, Tübingen, Germany, as were the B10.P mice [H2p]) background for nine generations and intercrossed to provide homozygous ... titrated in steps of 10 Plates (Costar; Corning Life Sciences, Oneonta, NY, USA) were coated with g/ ml of matrilin-1, 10 g/ ml of CII, or 10 g/ ml of cartilage oligomeric matrix protein (COMP) in ... non-MHC genes contribute to the differing pathogeneses IgG ( g/ ml) macrophages or of cells positive for MHC class II, CD4, or CD8 in tests using immunohistochemical stainings of cartilage tissue...
- 8
- 540
- 0
Báo cáo khoa học: " Immune-Mediated Fever in the Dog. Occurrence of Antinuclear Antibodies, Rheumatoid Factor, Tumor Necrosis Factor and Interleukin-6 in Serum." ppt
... counting for 50%, immunemediated disease 40% and neoplasia 10% of cases with diagnosed causes of FUO Dunn & Dunn (1998) sorted 101 dogs with FUO into main groups with the following result: infections ... high percentage of springer spaniels, German shepherd dogs and border collies, less than one year old and familiarly related, showing immune- mediated fever 169 and muscle and joint pain The present ... 9 9105 Feldman B: Fever of undetermined origin Compendium on continuing education for the practicing veterinarian 1980, 2, 970-977 Hansson H, Trowald-Wigh G, Karlsson-Parra A: Detection of antinuclear...
- 7
- 181
- 0
Báo cáo y học: "Effect of Acute Administration of an Herbal Preparation on Blood Pressure and Heart Rate in Humans"
... study ingested 39 mg of p-synephrine and 528 mg of caffeine the day before testing followed by ingestion of an additional 13 mg p-synephrine and 176 mg caffeine the next morning after an overnight ... Delves S, et al Metabolic and physiological effects of ingesting extracts of bitter orange, green.tea and guarana at rest and during treadmill walking in overweight males Int J Obesity 2006; 30: ... differences in pharmacological properties of the m- and p- isomers of synephrine can be explained on the basis of adrenergic receptor binding It is well known that, in general, binding to α-adrenergic...
- 6
- 490
- 0
Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt
... and ACCAGCTGGGCCAACATTTC; collagen III: TGGACAGATGCTGGTGCTGAG and GAAGGCCAG 3696 CTGTACATCAAGGA; alpha smooth muscle actin (a-SMA): AGCCAGTCGCCATCAGGAAC and CCGG AGCCATTGTCACACAC; and glyceraldehyde-3-phosphate ... 5¢-AGGTCGTCATCATCCCACGAG-3¢; TNF-a: 5¢-AACTCGAGTGACAAGCCCGTAG-3¢ and 5¢-GTAC CACCAGTTGGTTGTCTTTGA-3¢; IL -10: 5¢-CAGACCC ACATGCTCCGAGA-3¢ and 5¢-CAAGGCTTGGCAA CCCAAGTA-3¢; collagen I: TCCTGGCAATCGTGGTT CAA and ... dehydrogenase: 5¢-GGCACAGTCAAGGCTGAGAATG-3¢ and 5¢-ATGGTGGTGAAGACGCCAGTA-3¢ Immunocytochemical staining for NF-jBp65 MSCs in IMDM supplemented with 10% fetal bovine serum were plated on six-well glass...
- 11
- 653
- 0
Báo cáo hóa học: " Immune and hemorheological changes in Chronic Fatigue Syndrome" pdf
... Alterations in erythrocyte rheology may persist in CFS, these observations although indicative of indirect changes in deformation and aggregation suggests the need for further investigations to ... a pathogen [53] Exposure to pathogens in the presence of differential expression of certain NK cytokine and chemokine receptor genes may trigger a decline in CD56brightCD16- NK cells and NK cytotoxicity ... Viral Protein R (HIV-1 Vpr) upregulates TGF-b and decreases macrophage production of IL-12 causing a decline in cytotoxic activity and IFN -g [54] These mechanisms may be present in CFS and involve...
- 10
- 470
- 0
báo cáo hóa học: " Clinical usefulness of the screen for cognitive impairment in psychiatry (SCIP-S) scale in patients with type I bipolar disorder" doc
... 1997 Army Individual Test Battery: Manual of directions and scoring Washington, DC War Department, Adjutant General's Office; 1944 Rosen WG: Verbal fluency in aging and dementia J Clin Neuropsychol ... difficulty" and "good functioning" Results The control group was composed of 25 males and 20 females with a mean age of 37.69 (SD = 8.20) ranging from 20 to 54 years old Regarding their education ... supplemental scoring strategies, including errors of intrusion and perseverations on the verbal fluency and verbal learning subtests of the SCIP; these additional scores may offer valuable measures of frontal...
- 10
- 631
- 0
Báo cáo hóa học: " Clinical significance of elevated B-type natriuretic peptide in patients with acute lung injury with or without right ventricular dilatation: an observational cohort study" potx
... collection (including echocardiography measurements), data analysis, and manuscript preparation VK and TQ were involved in screening and consenting eligible study subjects and data collection XR and ... modification of the Bohr equation [20] Page of Table Baseline demographics and clinical characteristics of the 42 patients with acute lung injury Clinical characteristic Value Age 62 ± 17 Sex ... Society of Echocardiography’s Guidelines and Standards Committee and the Chamber Quantification Writing Group, developed in conjunction with the European Association of Echocardiography, a branch of...
- 7
- 446
- 0
the study of epidemiological characteristics, clinical manifestations of atypical pneumonia caused by bacteria in children
... protein reactive Protein C phản ứng Cộng ELISA IgG enzyme-linked immunosorbent assay Immunoglubulin G Kỹ thuật miễn dịch g n men Immunoglubulin G IgM Immunoglubulin M Immunoglubulin M IL Interleukin ... in increasing in antibiotic resistant, and prolonged treatment time Little is known about the epidemiology, clinical and laboratorial manifestations of atypical pneumonia in children, including ... consists of 128 pages including: Background and objectives: pages; Literature review: 34 pages; Methods: 18 pages; Results: 34 pages; Discussion: 37 pages; Conclusion: pages, and recommendation: page...
- 14
- 493
- 0
báo cáo khoa học: "Complete clinical response of metastatic hepatocellular carcinoma to sorafenib in a patient with hemochromatosis: A case report" ppsx
... increase of 44% in overall survival was seen, and a time- B Fig 1: Figure Positron1Emission Tomography imaging scan prior to and following therapy Positron Emission Tomography imaging scan prior to and ... competing interests Authors' contributions The original manuscript was written by BS All authors participated in drafting and editing the manuscript All authors read and approved the final manuscript ... unlike that seen in reported clinical trials of sorafenib In the SHARP trial, 83% of the 902 patients in the study had protocol deviation due to a variety of reasons The original dosing of sorafenib...
- 3
- 206
- 0
Báo cáo y học: " Zangfu zheng (patterns) are associated with clinical manifestations of zang shang (target-organ damage) in arterial hypertension" pot
... xu gan yang shang yan); Obstruction of phlegm and dampness of Heart/Liver/Gallbladder (xin gan dan shi tan bi); Qi and blood deficiency leading to Liver-yang rising (qi xue xu gan yang shang yan); ... World Health Organization: Health Research Methodology: a Guide for Training in Research Methods edition Genebra; 2001 59 Guang JY: The mode of thinking in Chinese clinical medicine: characteristics, ... KD § Kidney-yin deficiency and Liver-yang rising Obstruction of phlegm and dampness of Heart/Liver/ Gallbladder Qi and blood deficiency leading to Liver-yang rising Kidney-yin/ yang deficiency...
- 12
- 288
- 0
báo cáo hóa học:" Cyclic changes in gene expression induced by Peg-interferon alfa-2b plus ribavirin in peripheral blood " pot
... Interferon -induced protein 44, p44 8.4 interferon -induced protein 44-like 2.2 interferon induced with helicase C domain 4.8 interferon -induced protein with tetratricopeptide repeats 3.9 interferon -induced ... 1Fold-changes 2Fold-changes interferon, alpha-inducible protein 27 sialic acid binding Ig-like lectin 1, sialoadhesin chemokine (C-C motif) ligand radical S-adenosyl methionine domain containing interferon -induced ... binding protein 8, 38kDa glycophorin A (MNS blood group) glycophorin B (MNS blood group) glycophorin B (MNS blood group) glycophorin B (MNS blood group)///glycophorin E hemoglobin, delta hemoglobin,...
- 15
- 646
- 0
báo cáo hóa học: " Elimination kinetics of diisocyanates after specific inhalative challenges in humans: mass spectrometry analysis, as a basis for biomonitoring strategies" doc
... urine values were creatinine-corrected for each sample (the isocyanate concentrations were expressed in g per g of creatinine) Urinary creatinine was determined in grams per liter (g/ L) using ... sterile 100 mL polyethylene plastic containers and were asked to wash the hands before voiding to avoid dust failing into the sampling container (e .g from cloth and skin), The samples were placed in ... with their longer excretion times Interestingly, increasing the isocyanate load during the exposure challenge did not change the overall kinetic patterns, rather inducing a more prolonged horizontal...
- 8
- 433
- 0
Báo cáo y học: "Exercise-induced changes in interleukin-10 in patients with knee osteoarthritis: new perspectives" doc
... exercise, an elevation of serum levels of cartilage oligomeric matrix protein (COMP) was found in patients with OA, suggesting an effect on cartilage metabolism [8] These interesting new results allow ... understanding of the role of exercise in knee OA Relevant new research questions arise: Why is IL -10 upregulated after exercise? Could the increase in IL -10 and decrease in COMP be confirmed in comparable ... Page of exercise therapy results in cartilage degradation by affecting the low-grade in ammatory state Further research is required Abbreviations COMP, cartilage oligomeric matrix protein; IL, interleukin; ...
- 2
- 187
- 0
Báo cáo y học: "Epidermal wound healing in severe sepsis and septic shock in humans" pptx
... studying the basic biology of epidermal wound healing and the healing of burn injuries as well as the effect of jaundice and diabetes on epidermal wound healing [8-11] In this model, a prolonged ... subjects (Figure 3) It was also higher on the fourth day of healing (eighth day of the study) (Table 4) This suggests that both initial and induced wound inflammation are intensified in patients ... factor-alpha and interleukin- 1 and interleukin- 6 [38,39] It is possible that these mediators cause an increase in local inflammation, as well Nitric oxide (NO) is a mediator of early wound healing and inflammation...
- 7
- 486
- 0
báo cáo hóa học:" Clinical and psychological correlates of healthrelated quality of life in obese patients" ppt
... obtained in the past, and higher cumulative weight loss per year Scores on the Binge Eating Scale (BES) were in a range suggestive of binge eating in over one fourth of subjects, while over 10% of ... [21] The Binge Eating Scale was used to detect binging [22]; values in the range 17-26 were considered suspect of binge eating, whereas values ≥ 27 were taken as predictive of Binge Eating Disorder ... validation and norming J Clin Epidemiol 1998, 51(11) :102 5 -103 6 18 Dupuy HJ: The psychological general well-being (PGWB) inventory In Assessment of Quality of Life in Clinical Trials of Cardiovascular...
- 9
- 403
- 0
Báo cáo hóa học: " HPV vaccine: an overview of immune response, clinical protection, and new approaches for the future" pdf
... main characteristics of the immune response following VLPs are: VLPs are highly immunogenic [two log over the natural infection], inducing high concentrations of neutralizing Ab to L1, also in ... reports suggested that immunization against the minor capsid protein might work as a pan-HPV vaccine against different genotypes of papillomaviruses in addition to those causing genital warts and/ or ... systemic immune responses A rapid, potent, and sustained immunologic response to the administration of a quadrivalent vaccine (targeting HPV 6, 11, 16, and 18) and after a bivalent vaccine (targeting...
- 8
- 600
- 0
báo cáo hóa học:" Examining the dimensions and correlates of workplace stress among Australian veterinarians" docx
... among veterinarians in the Asia-Pacific region In Australia for example [11], the main stressors relating to working conditions were timerelated, including long working hours and having insufficient ... between stress and working in small animal practice, particularly regarding not having enough time per patient and the pressure to over-service or over-prescribe Interestingly, an investigation of ... not having enough holidays per year, not having enough rest breaks per day, the attitude of customers, lack of recognition from the public and not having enough time per patient Such findings are...
- 8
- 324
- 0
Báo cáo y học: "Clinical and neuroimaging correlates of abnormal short-latency Somatosensory Evoked Potentials in elderly vascular dementia patients: A psychophysiological exploratory study" pptx
... encephalopathy' (Binswanger's disease) [2] Although Computerized Tomography (CT) and Magnetic Resonance Imaging (MRI) may provide a detailed image of brain lesions, in many instances their findings are in contrast ... controls had normal findings (taking into consideration their age) concerning the peripheral nerves Abnormal SEPs suggesting a central nervous system dysfunction were present in 11 out of 14 (78.57%) ... Roman GC: Defining dementia: clinical criteria for the diagnosis of vascular dementia Acta Neurologica Scandinavica Suppllement 2002, 178:6-9 Hogervorst E, Bandelow S, Combrinck M, Irani S and...
- 7
- 325
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25