... above the significance cutoff, 'array density' ofthe peak, andthe P value for that peak The array density value is defined as the average number of arrayed elements used to calculate the window ... with a standard deviation of 0.35 anda mean of (black bars) The upper and lower bounds ofthe black dashed line represent extreme values for 10,000 simulated Gaussian distributions with the above ... window values for all windows that comprise the peak Therefore, the array density value provides an estimate ofthe number of actual raw data measurements that underlie each peak Properties of ChIP-chip...
... diseases” I STATE OF PLAY AT EUROPEAN LEVEL I.1 Unhealthy diets and lack of physical activity are the leading causes of avoidable illness and premature death in Europe, andthe rising prevalence ... a common forum for action the European Platform for Action on Diet, Physical Activity and Health was launched in March 2005 The Platform brings together all relevant players active at European ... attractiveness, availability, accessibility and affordability of fruits and vegetables? – On which areas related to nutrition, physical activity, the development of tools fortheanalysisof related disorders,...
... Influencing the Selection of Education, Marketing, and Law There are many other variables that can influence managers in their selection of education, marketing, and/ or law as classes of strategic tools ... predicted and tolerable level of externalities for tobacco use have changed dramatically in the past years, and as a result, policy with respect to managing tobacco usage behavior also has changed The ... education andthe force of law Within this framework, the manager can consider variables relevant to the selection of education, marketing, and law as sets of tools that can be brought to bear on the...
... and coordination All the authors read and approved the final manuscript References Regulation (EC) No 1394/2007 ofthe European Parliament andofthe Council of 13 November 2007 on advanced therapy ... purposed the assessment ofthe migration capacity ofthe cells At the moment there is no consensus in establishing acceptance criteria forthe migration capacity of BM-MNC in cardiac regeneration ... with eu Pharmacopoeia 2.6.1 (sterility) andthe validation ofthe potency assay in an ATMP that is constituted of bone-marrow mononucleated cells used in cardiac regeneration Materials and methods...
... that enables visualization of transcriptome data onto a linear map of an annotated bacterial genome and at the same time highlights additional features, such as putative regulatory sequences and ... terminators The combination of information extraction and visualization facilitates rapid, easy and intuitive analysisof genomics data, and in our research group Genome2D proved to be of great assistance ... as dataextraction and conversion algorithms, which are summarized in Table The combination of visualization and information extraction allows subsequent rounds of analyses, and thus an increase...
... precipitates The spectrum ofthe material reveals peaks for Ca and Sb The strong decrease ofthe Ca2+ pool in the pistil at the last stages of pistil development coincides with the degradation ofthe ... exudates (arrowheads) (E) In the stigma ofa flower without petals and anthers (stage 5), Ca/Sb deposits are less abundant and present mainly on the surface of degenerating papillae cells and ... external biotic and abiotic factors Furthermore, at this stage, the main task ofthe flower bud is to complete the growth and maturation of anthers andthe pistil Consequently, the intensity of the...
... significantly different cold-acclimation capacities, we prove that mathematical modelling of metabolism and validation by experimental data offers an attractive possibility forthe study ofcomplex ... slightly lower mean rates of carbon uptake before and during the first day of cold acclimation After days of cold exposure, the mean rate of carbon uptake was significantly lower for C24 than for Rsch ... 6-phosphate; 30% KOH was added to the control of each assay Reactions were incubated for 30 at 25 and °C, and then at 10 at 95 °C Anthrone 0.2% in 95% H2SO4 was added, andthe samples were incubated...
... oscillations The main result of such an analysis is that oscillations arise if the parameter k3 is the largest andthe parameters k6 and k7 are the smallest in the system Oscillations in this system can ... ones that may and ones that cannot exhibit oscillations may be useful fortheanalysisofthe existing models that are responsible forthe oscillations Such an analysis may help to understand the ... state, oscillations can be obtained Analysisof negative and positive subgraphs and comparison of their values gives rise to the estimation ofthe kinetic parameters that enable such oscillations...
... of EAMT, pages 52–57, Saint Rapha¨ l, France e 61 Mary Flanagan 1994 Error classification for MT evaluation In Proceedings of AMTA, pages 65–72, Columbia, Maryland, USA Ariadna Font Llitj´ s and ... searching among annotations B LAST can handle two types of annotations: error annotations and support annotations Error annotations are based on a hierarchical error typology, and are used to annotate ... postprocessing of statistical machine translation In Proceedings of LREC, pages 2175–2181, Valetta, Malta David Vilar, Jia Xu, Luis Fernando D’Haro, and Hermann Ney 2006 Error analysisof machine translation...
... Val334, and Val336 on M4 and Ala726 and Asp730 on M6 Alanine-scanning mutagenesis along segment M4 of yeast H+-ATPase showed that replacement of Ile331 and Val334 had little or no effect on ATP-dependent ... enzymes for which structural data are available MATERIALS AND METHODS Building the 3D model of PMA1_NEUCR In our approach, the model of PMA1_NEUCR was built using the ATC1_RABIT crystal structure as ... (1994) Computer analysisof bacterial haloacid dehalogenases defines a large superfamily of hydrolases with diverse specificity Application of an iterative approach to database search J Mol Biol...
... collection and analysis, and with DB collected all data All authors were involved in the development ofthe scale andthe interpretation ofthe results, helped draft the manuscript, and read and approved ... distally along the shoe), medial (greater medial than lateral wear at the heel and forefoot), which may indicate excessive pronation, or lateral (greater lateral than medial wear at the heel and forefoot), ... range of each measure across included footwear was also reported Intra-rater and inter-rater reliability for all categorical data was evaluated using percentage agreement, and kappa (κ) statistics...
... loss of functional competence ofthe spermatozoa The major advantage of AFM in pathological studies of spermatozoa is that it allows the evaluation of position and form ofthe acrosome Electron ... analyses of acrosome intact and acrosome-reacted human sperm heads [9] Structural changes ofthe hamster sperm head surface associated with maturation, capacitation and acrosome reaction has also been ... indicates that the area of medial sagittal plane ofthe anterior portions of acrosome-reacted sperm heads is approximately 40% less than those of intact heads Morphological alterations in spermatozoa...
... by a small sample size, the limited representativeness of participants, the lack ofa comparison, andthe assessment of intermediate outcomes For example, we have not evaluated the impact ofthe ... Italy: Center forthe Evaluation of Effectiveness of Health Care (Ce.V.E .A. S.), Modena Partner manager – Alessandro Liberati The Netherlands: Centre for Quality of Care Research, University of ... Hôtel Dieu, Paris Partner manager – Pierrre Durieux Italy: Unit of Clinical Governance, Agenzia Sanitaria Regionale (Regional Health Care Agency) of Emilia-Romagna, Bologna Partner manager – Roberto...
... breaks in apoptotic cells by the TUNEL labelling assay, to further validate the importance of cleaved caspase-3 as a relevant biomarker for apoptosis In an ideal setup these data would have been ... (GAPDH) (forward 5'AGAACGGGAAGCTTGTCATC; reverse 5'TGC-TGATGATCTTGAGGCTG) spanning an amplicon of 247 bp were always run in parallel for reasons of control RT-PCR products of caspase-3 were normalized ... histomorphological evaluation DB was responsible forthe surgical part ofthe investigation CM and ARR carried out the LIFE/DEAD-assay and 2-photon microscopy PZ was involved in the design ofthe study, evaluation...
... default This process is repeated and nodes b and c are placed in times and Table shows the table at this point Now, d and f are candidates for time In general, the algorithm chooses the candidate ... the graphical user interface but can be set in the command-line version of Jane Values of these parameters were systematically evaluated andthe best values found are used as defaults Jane can ... problem anda software package called Jane that implements our technique (The name “Jane” is used to indicate that this tools is complementary to Tarzan.) Specifically, Jane uses a dynamic programming...
... on the array, the geometric mean ofthe measured fluorescence intensities was calculated for both the experimental and control andthe ratio of these was used as a scaling factor to adjust the ... ofthe expression studies AP performed many ofthe expression studies andthe ChIP-chip analysis VL performed the ChIP-chip analysis CD participated in the design and printing ofthe array and ... University was supported by a grant from the National Institute for Allergy and Infectious Diseases, National Institutes of Health (NIAID/NIH) to Fatah Kashanchi Fatah Kashanchi and Steve Jacobson share...
... searching and querying capa- interactions SO also greatly facilitates the automatic validation of annotation data, as the relationships implied by an annotation can be compared to the allowable ... practical utility of SO as atoolfor data management and analysis, we have used SO to name and enumerate the parts of every protein-coding annotation in the D melanogaster genome Doing so has allowed ... the data are complexThe more formal approach afforded by SO means that analyses can be easily be extended beyond the domain of transcripts and exons to include many other gene parts and relationships...