holding the space with a deposit
The World with a Thousand Moons pdf
... elements He made up this formula, and tried it on a gravitation-paralysis case a space- man who's lain paralyzed for years The formula was designed to strengthen the human nervous system against the shock ... escort of armed pirates guarding them, and Dark and Holk Or ahead, they started through the jungle toward the pirate camp 38 Chapter Asteroid Horror T he pirate encampment was a big clearing hacked ... Captain Walls, himself an old-time space- man, was first of the group to appreciate the significance of the statement The captain gasped "A preventative for gravitation-paralysis? Kenniston, are you...
- 52
- 408
- 0
Báo cáo khoa học: Concerted mutation of Phe residues belonging to the b-dystroglycan ectodomain strongly inhibits the interaction with a-dystroglycan in vitro pot
... GTTAGTAGGTGAGAAATCGGCGGTTCAGTTTAACAGCAACA TGTTGCTGTTAAACTGAACCGCGCATTTCTCACCTACTAAC GAGAAATCGTGGGTTCAGGCCAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTGGCCTGAACCCACGATTTCTC TCGTGGGTTCAGTTTAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTAAACTGAACCCACGA ... GAGCTGGCTGTTGCTGTTAAACTGAACCCACGA TCTGCCCCTGGAGCCCTGCCCCA TGGGGCAGGGCTCCAGGGGCAGA CCTCGTCCTGCCGCCTCCAATGCTCTGGA TCCAGAGCATTGGAGGCGGCAGGACGAGG GCTCTGGAGCCTGACGCCAAGGCTCTGAGTATTGC GCAATACTCAGAGCCTTGGCGTCAGGCTCCAGAGC ... PCR (mutated nucleotides are in bold): 5¢-GTTGCTGTTAAACTGAACCGCCGAT-3¢ (Trp551 fi Ala), 5¢-GTTGCTGTTAGCCTGAACCCAC GAT-3¢ (Phe554 fi Ala), 5¢-GTTGCTTGCAAACTGAA CCCACGAT-3¢ (Asn555 fi Ala) and 5¢-GTTGCTGTTA...
- 15
- 337
- 0
Familiar Letters of John Adams and His Wife Abigail Adams During the Revolution with a Memoir of Mrs. Adams pot
... Familiar Letters of John Adams and His Wife by John Adams and Abigail Adams and Charles Francis Adam Abigail Adams During the Revolution, by John Adams and Abigail Adams and Charles Francis Adams ... men and measures, perhaps with a more sustained hand on account of the share her son was Familiar Letters of John Adams and His Wife by John Adams and Abigail Adams and Charles Francis Adam 15 then ... John Adams and His Wife by John Adams and Abigail Adams and Charles Francis Adam Two years elapsed, and his second daughter, the subject of this notice, was about to marry John Adams, then a lawyer...
- 269
- 350
- 0
Familiar Letters of John Adams and His Wife Abigail Adams During the Revolution with a Memoir of Mrs. Adams potx
... Familiar Letters of John Adams and His Wife by John Adams and Abigail Adams and Charles Francis Adam Abigail Adams During the Revolution, by John Adams and Abigail Adams and Charles Francis Adams ... men and measures, perhaps with a more sustained hand on account of the share her son was Familiar Letters of John Adams and His Wife by John Adams and Abigail Adams and Charles Francis Adam 15 then ... John Adams and His Wife by John Adams and Abigail Adams and Charles Francis Adam Two years elapsed, and his second daughter, the subject of this notice, was about to marry John Adams, then a lawyer...
- 269
- 481
- 0
the hero with a thousand faces commemorative edition vol 17 joseph campbell
... Viracocha, Weeping (Argen-tina) Plaque found at Andalgala, Catamarca, in northwest Argentina, tentatively identified as the pre-Incan deity Viracocha The head is surmounted by the rayed solar ... term, altjiranga mitjina, which refers to the mythical ancestors who wandered on the earth in the time called altjiranga nakala, "ancestor was." The word altjira means: (a) a dream, (b) ancestor, ... as an alternative to it, many people who are "un-villaged" recreate villages wherever they go Thus they gather with others at a crossroads, or at a certain cafe, the gyros shop, the bakery, the...
- 297
- 614
- 0
Báo cáo hóa học: " Research Article Equivalent Solutions of Nonlinear Equations in a Topological Vector Space with a Wedge" doc
... 323 of Mathematics and Its Applications, Kluwer Academic Publishers, Dordrecht, The Netherlands, 1995 [16] A M Rubinov, “Sublinear operators and their applications,” Russian Mathematical Surveys, ... Corollary 4.5(b) can be applied As it was said above (see Remark 4.3), in the case where K is a cone, Theorems 4.1, 4.2, and their corollaries guarantee that (1.1) has at most one solution Note again ... G Kre˘n and M A Rutman, “Linear operators leaving invariant a cone in a Banach space, ” ı American Mathematical Society Translations, vol 1950, no 26, p 128, 1950 [9] M A Krasnosel’ski˘, Positive...
- 25
- 370
- 0
annual report 2001 the bank with a human face ANZ
... Philippines, Singapore, Taiwan, Thailand and Vietnam Pacific American Samoa, Cook Islands, East Timor, Fiji, Papua New Guinea, Samoa, Solomon Islands, Tonga and Vanuatu Ian Richards Head of Strategy Future ... Reduced balance sheet intensity > No Project Finance Loan Arranger, Asia Pacific, (Dealogic Capital Data Project Ware) > No Project Finance Loan Arranger, Asia, (Dealogic Capital Data Project Ware) ... a year ANZ is a major partner in this endeavour and has already contributed $750,000 to the appeal ANZ and the Environment ANZ realises that it cannot separate its financial operations from the...
- 35
- 339
- 0
Chapter 052. Approach to the Patient with a Skin Disorder (Part 1) ppt
... >0.5 cm in diameter Wheal: A raised, erythematous, edematous papule or plaque, usually representing short-lived vasodilatation and vasopermeability Telangiectasia: A dilated, superficial blood vessel ... focuses on linear erosions overlying an area of erythema and scaling, he or she may incorrectly assume that the erosion is the primary lesion and the redness and scale are secondary, while the correct ... differential diagnosis (Table 52-4) For instance, the finding of scaling papules (present in patients with psoriasis or atopic dermatitis) places the patient in a different diagnostic category than...
- 5
- 413
- 0
Chapter 052. Approach to the Patient with a Skin Disorder (Part 2) potx
... epidermal atrophy) Scar: A change in the skin secondary to trauma or inflammation Sites may be erythematous, hypopigmented, or hyperpigmented depending on their age or character Sites on hair-bearing ... associated with xerosis and aged skin Systemic conditions that can be associated with pruritus include chronic renal disease, cholestasis, pregnancy, malignancy, thyroid disease, polycythemia vera, and ... hair-bearing areas may be characterized by destruction of hair follicles Table 52-3 Common Dermatologic Terms Alopecia: Hair loss; it may be partial or complete Annular: Ring-shaped lesions Cyst: A soft,...
- 5
- 334
- 0
Chapter 052. Approach to the Patient with a Skin Disorder (Part 4) doc
... lesions, the shape of individual lesions, and the arrangement of the lesions An ideal skin examination includes evaluation of the skin, hair, and nails as well as the mucous membranes of the mouth, ... erythematous exanthem is more likely to have a drug eruption than is a patient with a similar rash limited to the sun-exposed portions of the face Once the distribution of the lesions has been established, ... into the character of an eruption Thus, red papules on the lower extremities that blanch with pressure can be a manifestation of many different diseases, but hemorrhagic red papules that not blanch...
- 5
- 414
- 0
Chapter 052. Approach to the Patient with a Skin Disorder (Part 5) pptx
... A D The distribution of some common dermatologic diseases and lesions Figure 52-7 Psoriasis This papulosquamous skin disease is characterized by small and large erythematous papules and plaques ... skin disease is characterized by small and large erythematous papules and plaques with overlying adherent silvery scale Figure 52-8 ...
- 5
- 321
- 0
Chapter 052. Approach to the Patient with a Skin Disorder (Part 6) pdf
... contact (Fig 52-10) or primary irritant dermatitis In contrast, lesions with a generalized arrangement are common and suggest a systemic etiology Figure 52-9 Erythema multiforme This ... This eruption is characterized by multiple erythematous plaques with a target or iris morphology It usually represents a hypersensitivity reaction to drugs (e.g., sulfonylamides) or infections ... reaction to drugs (e.g., sulfonylamides) or infections (e.g., HSV) (Courtesy of the Yale Resident's Slide Collection; with permission.) Figure 52-10 ...
- 5
- 319
- 0
Chapter 052. Approach to the Patient with a Skin Disorder (Part 7) ppt
... psoriasis, or acne) 10 Social, sexual, or travel history as relevant to the patient DIAGNOSTIC TECHNIQUES Many skin diseases can be diagnosed on gross clinical appearance, but sometimes relatively ... or saucerized with a scalpel or removed by punch biopsy In the latter technique, a punch is pressed against the surface of the skin and rotated with downward pressure until it penetrates to the ... superficial anatomic structures in selected areas of the body In this procedure, a small area of skin is anesthetized with 1% lidocaine with or without epinephrine The skin lesion in question can be...
- 5
- 398
- 0
Chapter 052. Approach to the Patient with a Skin Disorder (Part 8) pptx
... noting the amount of blanching that occurs Granulomas often have an opaque to transparent, brown-pink "apple jelly" appearance on diascopy Figure 52-11 Urticaria Discrete and confluent, edematous, ... edematous, erythematous papules and plaques are characteristic of this whealing eruption Wood's Light A Wood's lamp generates 360-nm ultraviolet (or "black") light that can be used to aid the evaluation ... Wood's lamp, and previously unsuspected areas of involvement often become apparent A Wood's lamp may also aid in the demonstration of tinea versicolor and in recognition of ash leaf spots in patients...
- 5
- 367
- 0
Báo cáo toán học: "Using Lov´sz Local Lemma in the space of a random injections" pptx
... general lemma Lemma Assume that G is a negative dependency graph for the events A , A2 , , An Assume further that V (G) has a partition into classes, such that any two events in the same class have ... = Pr (A1 |A2 ∧ A3 ∧ ∧ Ak ∧ Ak+1 ) Consider a set A with |A| = a and a set B with |B| = b, and assume a ≤ b Consider a random function f from A to B For u ∈ A, define the event Au = the value f ... that a random A → A function is an injection, is at least (1 − p (A1 ) )a = (1 − 1 /a) a (a 1) = ( − o(1) )a , pretty close to the e √ correct asymptotics a! /aa = 2πae a (1 + o(1)) Packing problem A...
- 13
- 208
- 0
Báo cáo khoa học: "Highly malignant soft tissue sarcoma of the extremity with a delayed diagnosis" ppsx
... and ankle joint (three cases), the forearm (four cases), and the popliteal area (one case) Pulmonary metastasis was detected at diagnosis in all alveolar soft part sarcoma cases and in one clear ... one case of synovial sarcoma (Figure 1) and one case of alveolar soft part sarcoma showed calcification on plain radiographs In all three cases of alveolar soft part Figure A plain radiograph ... MRI images of an alveolar soft part sarcoma (A) An axial T1-weighted fat-suppressed image and (B) an axial T2-weighted image High signal on T1FS, T2WI with multiple signal voids are apparent...
- 5
- 286
- 0
báo cáo khoa học: "Primary malignant mixed Müllerian tumor arising from the mesorectum with a synchronous ovarian cancer: a case report and review of the literature" ppsx
... Levine DA, Argenta PA, Yee CJ, Marshall DS, Olvera N, Bogomolniy F, Rohaman JA, Robson ME, Offit K, Barakat RR, et al: Fallopian tube and primary peritoneal carcinomas associated with BRCA mutations ... interpreted the pathologic findings TFC took part in the critical revision and JYW took part in the surgical approach and final approval of the manuscript All authors have made substantive intellectual ... Liao SY, Buller RE, Manetta A, Berman ML, McMeekin S, Bloss LP, DiSaia PJ: Extraovarian peritoneal serous papillary carcinoma: a casecontrol retrospective comparison to papillary adenocarcinoma...
- 5
- 475
- 0
Báo cáo y học: "Reconstruction of the urethra with a Surgisis onlay patch in urethral reconstructive surgery: two case reports" pdf
... urethral stricture was found Biodegradable grafts seem to be an ideal solution for the repair of the urethra as well as other segments of the urinary tract SIS acts like a framework for the host-tissue ... cm distally and proximally of the respective stricture, a Surgisis® patch was cut and inserted, in the same way as a buccal mucosal free graft would be inserted, using a × monofile thread with ... described, and various types of autologous materials have been used in order to bridge urethral defects [1] In some cases, the search for new applicable materials became mandatory because of the morbidity...
- 4
- 292
- 0
Báo cáo y học: " Penetrating injury of the hand with a door handle: a case report" ppt
... Lateral radiograph of hand debridement and washout was performed The wound was then reviewed after 48 hours and a delayed primary closure performed The patient had regained good hand function and ... Antero-posterior radiograph of hand Sinha M: An unusual foreign body in the hand J Hand Surg Eur Vol 2007, 32(2):231-232 Chaudhry IA, Al-Sharif AM, Shamsi FA, Elzaridi E, Al-Rashed W: Severe ocular injuries ... initial management of the patient and reviewed the manuscript NS was the senior author responsible for the management of the patient References Figure Antero-posterior radiograph of hand Antero-posterior...
- 3
- 266
- 0
Báo cáo toán học: " Shrinking projection algorithms for equilibrium problems with a bifunction defined on the dual space of a Banach space" doc
... Inspired and motivated by Ceng et al [2], Takahashi and Zembayashi [14], Takahashi and Zembayashi [9], the main aim of this paper is to introduce and investigate a new iterative method for finding a ... Banach spaces Taiwanese J Math 14, 1023–1046 (2010) 12 Kohsaka, F, Takahashi, W: Generalized nonexpansive retractions and a proximal-type algorithm in Banach spaces J Nonlinear Convex Anal 8, ... real Banach space with the dual space E* The norm and the dual pair between E and E* are denoted by ║·║ and 〈·,·〉, respectively The weak convergence and strong convergence are denoted by ⇀ and...
- 11
- 396
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25