high content rna interference assay analysis of tau hyperphosphorylation as a generic paradigm
high resolution separation and analysis of biological macromolecules, part a
... rain FIG Separation of two deamidatcd ribonuclease A variants labclcd as dl-RNase A (isoaspartic acid form) and d2-RNase A (aspartic acid form) by HIC Column, Spherogel HIC-CAA; 10-min linear ... another example of the power of HIC, Fig (page 42) shows the separation of different forms of deamidated ribonuclease A 59 One (dlRNase A) has an isoaspartic acid and the other has an aspartic acid ... equally applicable to the analysis of enzymatically derived mixtures of peptides and also for the analysis of synthetically derived peptides An example of the high- resolution analysis of a tryptic...
- 635
- 419
- 0
Báo cáo y học: "High-throughput RNA interference screening using pooled shRNA libraries and next generation sequencing" ppsx
... genomic DNA were recovered by PCR amplification using the following primers: p5+mir30: 5’-AATGATACGGCGACCACCGACTAAAGTAGCCCCTTGAATTC3’ p7+Loop: 5’-CAAGCAGAAGACGGCATACGATAGTGAAGCCACAGATGTA-3’ PCR was ... primarily mediated by non-protein-coding RNA transcripts, known as microRNAs (miRNAs) miRNAs are produced in a similar manner to mRNAs, but miRNAs are processed into shorter RNA species containing ... Applied AATGATACGGCGACCACCGA Biosystems (20mer) and oligos: and P5 P7 CAAGCAGAAGACGGCATACGA (21mer) at 250 nM each For TaqMan only, 250 nM of a 21mer dual-labelled probe was included (CCCTTGAATTCCGAGGCAGTA),...
- 41
- 439
- 0
Báo cáo y học: " Dual role of TRBP in HIV replication and RNA interference: viral diversion of a cellular pathway or evasion from antiviral immunity?" potx
... specificity of action [10] Adenovirus VA RNAI and VA RNAII are cleaved by Dicer and act as RNAi suppressors [13] Both Tat protein and VA RNAs inhibit Dicer activity A striking feature of RNAi suppressors ... protein kinase R (PKR), inhibit RNAi pathways in plants and in Drosophila cells [12] HIV-1 Tat protein acts as an RNAi suppressor in the pathway mediated by shRNAs but not siRNAs, suggesting a specificity ... Lancaster AM, Lemon SM, Sarnow P: Modulation of hepatitis C virus RNA abundance by a liver-specific MicroRNA Science 2005, 309:1577-1581 Sheldon M, Ratnasabapathy R, Hernandez N: Characterization...
- 6
- 242
- 0
Báo cáo y học: "RNA interference pinpoints regulators of cell size and the cell cycle" doc
... Bursteinas B, Gao Q, Zvelebil M, Baum B: FLIGHT: database and tools for the integration and cross-correlation of large-scale RNAi phenotypic datasets Nucleic Acids Res 2006, 34(Database issue):D479-D483 ... RNAi analysis of growth and viability in Drosophila cells Science 2004, 303:832-835 DasGupta R, Kaykas A, Moon RT, Perrimon N: Functional genomic analysis of the Wnt-wingless signaling pathway ... large, searchable databases containing data from different RNAi screens will become crucial to interpreting the results of these genomic approaches [8] Correlation of the rich dataset generated by...
- 3
- 197
- 0
Tài liệu Transformation through Integration An Activity Theoretical Analysis of School Development as Integration of Child Care Institutions and the Elementary School ppt
... cultural-historical activity theory and was carried out as participant observation and action research The study addresses the question of the potentials and alternative goals for change and development ... significance that play has for learning as strongly as Fröbel had done Play June 28, 1840 was the date of the inauguration of the public German kindergarten This day was chosen by Fröbel because ... (bottenskola) as a base for all further education At the time of the two world wars the debate about the school took place as a fight about when, i.e., at what grade and age, the students should be separated...
- 336
- 322
- 0
Tài liệu Cost –Benefit and Usage Behaviour Analysis of No Frills Accounts: A Study Report on Cuddalore District doc
... the average usage behaviour of accounts from the transaction data and the market interest rates that prevail 16 S Thyagarajan & Jayaram Venkatesan: Cost –Benefit & Usage Behaviour Analysis of ... Chidambaram Semi urban 1086 31 Lakshmi Vilas Bank Bhuvanagiri Semi urban 537 31 Pallavan Grama Bank Sethiathope Rural 1014 40 Pallavan Grama Bank Cuddalore Urban 935 51 SBI Chidambaram Semi urban ... 561 Total Table 5.1.1 31 S Thyagarajan & Jayaram Venkatesan: Cost –Benefit & Usage Behaviour Analysis of No Frills Accounts transactions and balance maintained - was considered important as it...
- 54
- 462
- 1
Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf
... ligand had a cooperative character It leads to higher uorescent response and better xation of CBC Final stabilization of IF30CBCIF20 can occur after series of transitions at the domaindomain ... detecting chip (Fig 6) All the above facts mean that the intestinal uptake of analogues can be quite feasible In this regard we plan to examine a group of analogues concerning details of their binding ... Preparation of the unsaturated apo-form of IF was although modied Thus, the Cbl-saturated holo-IF (1 mgặmL)1) was dialysed against 20 volumes of m urea (30 C) instead of m GdnHCl The incubation...
- 12
- 603
- 0
The Treatment of Uncertainty in EPA’s Analysis of Air Pollution Rules: A Status Report pot
... for Lead, October Research Triangle Park, NC: Office of Air Quality Planning and Standards www.epa.gov/ttn/ecas/regdata/RIAs/finalpbria.pdf ——— 200 9a Proposed NO2 NAAQS Regulatory Impact Analysis ... Regulatory Impact Analysis, 2006 National Ambient Air Quality Standards for Particulate Matter, Chapter Research Triangle Park, NC: Office of Air Quality Planning and Standards, October www.epa.gov/ttn/ecas/regdata/RIAs/Chapter%205 ... uncertainty analyses and make available a presentation of the uncertainty analysis that would be clear and transparent to decisionmakers and to other interested readers Analysis of benefits for EPA...
- 24
- 427
- 0
Báo cáo khoa học: "Semantic Analysis of Japanese Noun Phrases: A New Approach to Dictionary-Based Understanding" doc
... and a semantic role of a head word All definition sentences in RSK were analyzed by JUMAN, a Japanese morphological analyzer, and KNP, a Japanese syntactic and case analyzer (Kurohashi and Nagao, ... phrases where conventional classification-based analysis failed As a result, we can arrange the diversity of N1 no N2 senses simply as in Table The semantic-role relation is a relation that N1 ... the parsing system In Proceedings of the First International Conference on Language Resources ~ Evaluation, pages 719724 Sadao Kurohashi, Masaki Murata, Yasunori Yata, Mitsunobu Shimada, and Makoto...
- 8
- 553
- 0
An Analysis of Power Consumption in a Smartphone doc
... (codec and amplifier), internal NAND flash, and SD card Since the graphics module had too many supply rails to measure directly, we instead used a combination of direct and subtractive measurements ... SD, NAND, CPU and RAM power for flash storage read and write benchmarks WiFi Flash storage Bulk storage on the Freerunner device is provided by 256 MiB of internal NAND flash, and an external micro ... NAND flash and SD card, as well as the CPU and RAM, averaged over 10 iterations of each workload Table shows the corresponding data throughput, efficiency (including NAND/SD power and the CPU and...
- 14
- 719
- 0
Báo cáo khoa học: "Historical Analysis of Legal Opinions with a Sparse Mixed-Effects Latent Variable Model" potx
... SVM, as a strong large margin learner, is a more natural approach in a binary classification setting, but might not be the best choice in a fourway or multiclass classification task 5.1.2 Comparing ... Kentucky Assembly, marshaled, classed railroadco, statute, Alabama, steamboats, Waterman’s, mulattoes, man-trap Free Region (R1) Slave Region (R2) apprenticed, overseer’s, Federal Army, manumitting, ... also conduct a more formal analysis comparing the SME classification to that conducted by a legal historian Wahl (2002) analyses and classifies by hand 10989 slave cases in the US South into categories:...
- 10
- 290
- 0
Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot
... presence of TULV S RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855) To monitor the presence of ... presence of recS -RNA on the passages was monitored by RT-PCR and the isolate appeared to have a stable genotype (data not shown) RecTULV formed foci similar in size to those of the original variant and ... V-type S RNA was detected during all ten passages while the REC-type totally disappeared after the 5th passage (data not shown) These data confirmed our earlier observation [11] that the transfection-mediated...
- 5
- 483
- 0
Báo cáo hóa học: "Analysis of airway secretions in a model of sulfur dioxide induced chronic obstructive pulmonary disease (COPD)" potx
... Furusho S, Kita T, Katayama N, Abo M, Ohkura N, Herai Y, Hori A, Ishiura Y, Nobata K, Ogawa H, Yasui M, Kasahara K, Nakao S: Comparison of cough reflex sensitivity after an inhaled antigen challenge ... conterstain The AgNOR analysis was performed by counting the number of AgNOR (black dots) per cell at a magnification of 1000× (each group n = animals) Analysis of data The secretory basal and stimulated ... does not automatically lead to an improvement of clinical symptoms in airway diseases such as allergic asthma [66], other features of airway diseases such as hypersecretion or cough are currently...
- 10
- 568
- 0
báo cáo hóa học:" Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" ppt
... presence of TULV S RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855) To monitor the presence of ... presence of recS -RNA on the passages was monitored by RT-PCR and the isolate appeared to have a stable genotype (data not shown) RecTULV formed foci similar in size to those of the original variant and ... V-type S RNA was detected during all ten passages while the REC-type totally disappeared after the 5th passage (data not shown) These data confirmed our earlier observation [11] that the transfection-mediated...
- 5
- 430
- 0
Báo cáo toán học: " Context-aware visual analysis of elderly activity in a cluttered home environment" docx
... elderly activity analysis They proposed a method for learning models of spatial context from tracking data A standard overhead camera was used to get tracking information and to define inactivity and ... Table Summary of the state of the art visual elderly activity analysis approaches Paper Cameras Context Test environment Features used Naustion et al [3], Haritaoglu et al [4], Cucchiara et al [5], ... using a common one-against-all (OAA) approach It decomposes an M-class problem into a series of binary problems The output of OAA is M SVM classifiers with the ith classifier separating class i...
- 14
- 438
- 0
Báo cáo hóa học: " Research Article Statistical Analysis of Hyper-Spectral Data: A Non-Gaussian Approach" pot
... as possible and that only have a few parameters For these reasons in our analysis, we considered two classes of mixture models that have few parameters and that are characterized by a high mathematical ... a measurement campaign held in Italy in 2002 The aim of the campaign was to collect data to support the development and the analysis of classification and detection algorithms The data were gathered ... the statistical behavior of each background class in real hyper-spectral images has been investigated The availability of statistical models that properly describe hyper-spectral data variability...
- 10
- 332
- 0
Báo cáo lâm nghiệp: " Quantification of nutrient content in the aboveground biomass of teak plantation in a tropical dry deciduous forest of Udaipur, Indi" pdf
... aboveground biomass of teak plantation, Udaipur, Rajasthan, India N Component Table Concentration of nutrients (% ± 1.s.e.) in the aboveground biomass of teak plantation, Udaipur, Rajasthan, India 1.79 ... biomass of the stand for different diameter classes Table Distribution of diameters at breast height (dbh) in the experimental site stand of teak plantation, Udaipur, Rajasthan, India Diameter ... Management of Soil, Water and Nutrients in Tropical Plantation Forests Australian Centre for International Agricultural Research (ACIAR), Monograph No 43 Canberra, Canberra Publishers: 571 NARWAL...
- 6
- 353
- 0
Báo cáo khoa học: " Fractionated stereotactic radiotherapy for skull base tumors: analysis of treatment accuracy using a stereotactic mask fixation system" pps
... displacements seen in the directions was calculated The amount of isocenter shift of serial CT scans was assessed using analysis of variance (ANOVA) for repeated measures During CT localization and ... semicircular metal frame, an upper and a lower mask conformed to the anterior and posterior surfaces of head, two lateral carbon bars for fixing the thermoplastic mask, and a mouth bite Page of patient’s ... on a thermoplastic mask, assessing the accuracy of isocenter relocation by serial CT scans and portal imaging The accuracy of isocenter relocation evaluated by fusion between localization and...
- 6
- 311
- 0
báo cáo khoa học: " Transcriptomics and molecular evolutionary rate analysis of the bladderwort (Utricularia), a carnivorous plant with a minimal genome" pptx
... gibba mitochondrial region used in phylogenetic analysis (A) Mitochondrial genome comparison of Arabidopsis thaliana, Brassica napus, Carica papaya, Nicotianan tabacum and Vitis vinifera and ... performed assembling, annotation, database construction, statistical analysis and manuscript writing VAA contributed to data analysis, phylogenetic analysis, drafting and editing of the manuscript CAPT ... database Additional file 9: Figure S2 - Validation of PEGs by qRT-PCR Expression patterns of APETALA1, APETALA3, PISTILLATA, AGAMOUS, SEPALATA3, CLAVATA1, MYB21, MYB24, RBCS-1B, SBPase, a- glucosidase,...
- 16
- 434
- 0
báo cáo khoa học: " Characterization and structural analysis of wild type and a non-abscission mutant at the development funiculus (Def) locus in Pisum sativum L" pdf
... development of leaves of Sambucus nigra and response of cells to auxin and ethylene Planta 1976, 132:197-204 Gonzalez-Carranza ZH, Whitelaw CA, Swarup R, Roberts JA: Temporal and spatial expression of a ... leaf variety of pubescent birch has also been described [34] Peas are one of the world's most important grain legumes and serve as a valuable protein source in the diet of humans and animals According ... Taylor JE, Coupe SA, Picton S, Roberts JA: Charaterization and accumulation pattern of an messenger RNA encoding an abscission related β-1,4-glucanase from leaflets of Sambucus nigra Plant Mol Biol...
- 7
- 372
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25