hadn apos t seen my cousin for years and all of a sudden he showed up at my workplace yesterday
báo cáo hóa học:" Research Article Accurate Asymptotic Formulas for Eigenvalues and Eigenfunctions of a Boundary-Value Problem of Fourth Order" pdf
... supported by The Scientific and Technological Research Council of Turkey ă TUBITAK The author would like to thank the referee and the editor for their helpful comments and suggestions The author ... Assume that q x ∈ C 0, π and the conditions q π − q 0 and q π − q / hold Based on the asymptotic expressions of the fundamental solutions of 1.1 and the asymptotic formulas for eigenvalues of the ... Boundary Value Problems using the obtained asymptotic formulas for eigenvalues and eigenfunctions, the basis properties of the root functions of the operators were investigated The paper is organized...
- 21
- 283
- 0
ATOMIC 2s 3p TRANSITION FOR PRODUCTION AND INVESTIGATION OF a FERMIONIC
... photoassociation rate to molecular states of potentials correlated to the 2S-3P asymptote are calculated This is a free-bound transition and the calculation of the overlap integral between the initial and ... first electronically excited state At large atomic separations, these potentials approach the nS-nP asymptote, where n is the principal quantum number and S and P indicate the atomic orbital of the ... the thermal de Broglie wavelength T and the average atomic separation in the dilute gas become comparable, the wave functions of the atoms start to spatially overlap such that they have to be...
- 167
- 733
- 0
Báo cáo y học: " Multiple functions for CD28 and cytotoxic T lymphocyte antigen-4 during different phases of T cell responses: implications for arthritis and autoimmune disease" pot
... model for cytotoxic T- lymphocyte antigen-4 (CTLA-4) The traditional view of the function of CTLA-4 is that it is upregulated upon stimulation of the T cells and attenuates the response (top) The ... cell activation rather than terminating AICD Thus, these unactivated or incompletely activated T cells are not prone to AICD and not upregulate FasL [63] CTLA-4 ligation in previously activated ... of surface CTLA-4 after the activation of T cells is detectable on proliferating cells with an activated phenotype indicates that during an optimal T cell response the CTLA-4-mediated inhibition...
- 10
- 393
- 0
Báo cáo sinh học: "Cumulative t-link threshold models for the genetic analysis of calving ease scores" pptx
... potentially leading to a more stable implementation with justification provided by Satagopan et al [38] but with their context being the stabilization of the Bayes factor estimator of Newton and ... datasets were generated from each of two different populations as characterized by the distribution of the liability residuals Population I had a residual density that was standard Student -t ... posterior standard deviations for each (co)variance component and the final chain starting at the posterior mean plus posterior standard deviations for each (co) variance component As with the simulation...
- 24
- 263
- 0
BUSINESS TRATEGY FOR THE BANK FOR INVESTMENT AND DEVELOPMENT OF VIETNAM YENBAI BRANCH IN THE PERIOD OF YEARS 2010 2015
... will have effects on the success and strategies of a enterprise The growth rate of the economy, interest rates, exchange rate and inflation are main targeted factors in the analysis of the enterprise ... of the temporary idle capital of the organizations and individuals in the area, striving to achieve an average growth rate at least equal to the average rate in the region to improve the position ... market Market, market share is a measure that shows the location of the branch in the provinces of the northern mountainous area of the Bank for Investment and Development of Vietnam system and...
- 102
- 369
- 0
The Use of Selected Medicinal Herbs for Chemoprevention and Treatment of Cancer, Parkinson’s Disease, Heart Disease, and Depression
... contain an array of anthocyanins and polyphenols which have high antioxidant activity and anti-inflammatory activity It is possible that these kinds of constituents act synergistically at target ... intervals measure the robustness and stability of the estimate of the odds ratio, and if the confidence interval excludes 1.0, then there is a statistically significant association This means that ... mixture Both the aglycone structure and the attached sugar moiety affected the superoxide radical- and peroxynitiritescavenging activities, although the effect of the attached sugar moiety was smaller...
- 57
- 683
- 0
Design, fabrication, and characterization of a solenoidsystem to generate magnetic field for an ECR proton source
... temperature epoxy for the outer layer insulation The iron jacket of the solenoid coils was fabricated from 10 mm thick low carbon TATA A grade steel The jacket was fabricated in five parts consisting ... profiles along the axial distance for (a) mirror magnetic field, and (b) at magnetic field the magnetic field can cause diffusion of the plasma particles to the wall of the plasma chamber The measured ... shield the adjacent components The use of electromagnet has wide flexibility of tuning the plasma to get the best operating conditions The use of electromagnet (instead of permanent magnets) helps...
- 8
- 650
- 0
Tài liệu Ecology and Management of a Forested Landscape Fifty Years on the Savannah River Site pptx
... Settlement Vegetation For the past ten thousand years, oak and pine forests have dominated the SRS area Pine species probably have dominated the uplands of the area for the past four to five thousand years ... habitats and managing them to provide for the habitat requirements of native flora and fauna In summarizing fifty years of research into the biotic communities and native species of the Savannah ... Savannah River Site 152 Table 4.10 Habitats of aquatic insects on the Savannah River Site 162 Table 4.11 Habitats of aquatic arthropods on the Savannah River Site 165 Table 4.12 Habitats of other...
- 513
- 1,719
- 0
Tài liệu Báo cáo khoa học: "Collecting a Why-question corpus for development and evaluation of an automatic QA-system" pdf
... improve the data quality, a HIT can also be attached to certain tests, “qualifications” that are either system-provided or created by the requester An example of a system-provided qualification is the ... creates tides that stabilize Earth’s axis Without this stability, its variation, known as precession of the equinoxes, could cause weather to vary so dramatically that it could potentially suppress ... average of the best matches between two assignments within one HIT (Best Match) We ran the test for two data sets: The most typical case of the workers cheating was to mark the question unaswerable...
- 9
- 610
- 1
Tài liệu Báo cáo khoa học: "NLP for Indexing and Retrieval of Captioned Photographs" pot
... that allows SOC officers to upload digital photographs and their descriptions in a central database, index the photographs automatically according to these textual descriptions and retrieve them ... are case grammar constructs structured in a slot-assertion notation Our approach is similar in the use of an ontology for the domain and in the fact that transformations are applied to the "superficial" ... our prototype extracts meaning representations that capture pragmatic relations between objects depicted in the photographs Therefore, most of the complexity of the written text is eliminated,...
- 4
- 413
- 0
Dynamic Vision for Perception and Control of Motion ppt
... called the “root node” and is drawn as the topmost node in standard notation The letter T shall designate all transformations for uniformity (both translations and rotations) The standard way of ... to the United States or European standard), for frame grabbing and communication of the (huge amount of) image data, as well as for feature extraction, hypothesis generation, and state estimation ... respect to handling homogeneous coordinates Concatenation is shifted to the evaluation of the scene model at runtime; then, both the nominal total HTM and the partial-derivative matrices for all...
- 490
- 534
- 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt
... coordinate, and evaluate innovative and effective outreach and education programs to target at- risk populations and to increase awareness in the general population about hepatitis B and hepatitis ... units are settings that serve populations that are at risk for hepatitis B and hepatitis C The populations that use the settings may not have access to care through traditional health-care venues ... factors associated with hepatitis B and hepatitis C Information about hepatitis B and hepatitis C prevention, hepatitis B immunization, and medical monitoring of chronically infected patients...
- 191
- 457
- 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc
... Other Settings That Target At- Risk Populations STD and HIV clinics, shelter-based programs, and mobile health units are settings that serve populations that are at risk for hepatitis B and hepatitis ... MMTP methadone maintenance treatment program NASTAD National Alliance of State and Territorial AIDS Directors NAT nucleic acid test NCHHSTP National Center for HIV/AIDS, Viral Hepatitis, Sexually ... hospital and nonhospital health-care settings I nformation about discrimination and stigma associated with hepatitis B and hepatitis C and guidance on reducing them I nformation about health...
- 253
- 369
- 0
Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf
... important for interdomain interactions The N-terminal part of the strand interacts with the N-terminal part of helix CG in domain G, and the C-terminal part interacts with the turn before helix ... possibly affect the switch I conformation Mutation affects the FA-binding site [22] Interpretation of mutation Table Structural interpretations of all known FA resistance mutations Residues are numbered ... a- phosphate and b-phosphate, and two so-called switch regions, which coordinate the c-phosphate and change conformation between a tense GTP state and a relaxed GDP state [17] Ribosomal complexes that...
- 15
- 474
- 0
Báo cáo khoa học: Synthesis and characterization of a new and radiolabeled high-affinity substrate for H+/peptide cotransporters pdf
... component (4%) was subtracted from the total uptake to calculate the carrier-mediated uptake Inset: Eadie–Hofstee transformation of the specific Gly-Sar uptake data [S, Gly-Sar concentration (mM); ... peptide transporters I Knutter et al ¨ amounts of substrate (1 or 20 mm, respectively) and subtracted from the total uptake rates For both substrates, the relationship between carrier-mediated uptake ... h and reached a plateau after h of incubation (Fig 4) The uptake was found to be saturable: unlabeled Bip-Pro at a concentration of mm strongly inhibited Bip-[3H]Pro uptake at all time points...
- 10
- 490
- 0
Báo cáo khoa học: MR solution structure of the precursor for carnobacteriocin B2, an antimicrobial peptide fromCarnobacterium piscicola Implications of the a-helical leader section for export and inhibition of type IIa bacteriocin activity pdf
... indicated, as are the residues at the start and finish of each a- helix The position of the double glycine motif where cleavage occurs during maturation of the bacteriocin is indicated by an arrow ... Gram-positive bacteria, thereby hindering the ability of the prebacteriocin to fully interact with the target receptor These observations are consistent with the maintenance of significant antibacterial ... by an 18-amino acid leader peptide, which is cleaved at the Gly–Gly site during the maturation process to liberate the active peptide The goal of this study was determination of the 3D solution...
- 9
- 519
- 0
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx
... (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) ... TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT GACCGCCTCCC-3¢); for Golf (5¢-GGTACCGCTGCAA TGGGGTGTTTGGGCAAC-3¢) and (5¢-GCGGCCGCCT CAGATCACAAGAGTTCGTACTGC-3¢); for Ga15 (5¢ -AT ... vector was obtained from pJH2-SSTR2 by homologous recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢)...
- 14
- 473
- 0
Báo cáo khoa học: Discovery and characterization of a Coenzyme A disulfide reductase from Pyrococcus horikoshii Implications for the disulfide metabolism of anaerobic hyperthermophiles doc
... TTGAGAACCCTAGC-3¢) (for the P horikoshii CoADR), and TG104 (5¢-CGCGCCATGGAAAAGAAAAAGGTA GTCATAA-3¢) and TG105 (5¢-CGCGGTCGACCTAGAA CTTCAAAACCCTGGC-3¢) for the P furiosus CoADR The N terminus of the CoADRs ... It was necessary to correct for the mass of the tube due to concentration of the enzyme solution from the small amount of evaporation that took place at high temperature Thermoactivity assays ... is not shown that NADH is available to be used ‘on demand’ when a substrate appears while at the same time avoiding the stabilization of a reduced flavin intermediate that could react undesirably...
- 12
- 420
- 0
Báo cáo khoa học: "Generating Usable Formats for Metadata and Annotations in a Large Meeting Corpus" pptx
... Create and populate the annotation database Adapt the XSLT stylesheets as needed for various annotations and/ or table formats 4 Metadata: Generation of Explicit Files and Conversion to Tabular ... XSLT stylesheet to each annotation file according to its type, and generates the global tab-separated files for each annotation The script also generates an SQL script that creates a relational annotation ... definitions are not universally accepted, but they allow us to separate the two types of information The main goal of the present work is to facilitate the use of the AMI Corpus metadata and annotations...
- 4
- 373
- 0
Báo cáo Y học: Identification and characterization of a new gene from Variovorax paradoxus Iso1 encoding N -acyl-D-amino acid amidohydrolase responsible for D-amino acid production pdf
... reported that the enzyme activity of N-D-AAase is affected by the presence of metal ions Thus, the enzyme was treated with EDTA, EGTA, 1,10-phenanthroline and metal ions at concentrations of and ... was preincubation for 30 at various temperatures Then the substrate (N-acetyl-D-methionine, 25 mM, pH 7.5) was added to the reaction and the activity was measured at 40 °C for 20 The highest activity ... positive for catalase, oxidase and nitrate reduction but negative of hydrolysis for gelatin and starch Therefore, according to all above analysis results, the strain Iso1 was clearly a strain of...
- 11
- 656
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25