gouy chapman model provides a potential dependence of the capacitance but at what cost
Modern electrochemistry, vol 2a fundamentals of electrodics, 2nd edition john OM bockris, amulya k n reddy, maria gamboa aldeco
... Double Layer The Gouy Chapman Model Provides a Potential Dependence of the Capacitance, but at What Cost? Some Ions Stuck to the Electrode, Others Scattered in Thermal Disarray: The Stern Model The ... nature, and many of them carry a charge A substantial part of the understanding of nature is dependent upon a satisfactory model of charged interfaces However, there are also the reasons that ... for that matter, the walls of the container The frontier is reached What happens at such a phase boundary? It will be shown further on that the phases on either side of the boundary become charged...
- 817
- 4,667
- 0
Báo cáo y học: "Proteinase-activated receptor-2: two potential inflammatory mediators of the gastrointestinal tract in Atlantic salmon" ppt
... CAAAGCCAACAGGGAGAAGATGA ACCGGAGTCCATGACGATAC AAGTGAAGCAGGAGGGTGGAA CAGCCTCACCCCATTTGATG TACAGTGAAACTGCGAATGG GCATGGGTTTTGGGTCTG AF321836 AF321836 AF012125 AF012126 BU693999 BU693999 AJ427629 AJ427629 ... TGGACTCCCCTGAAGATTGCCTACCAC CTGGACACCTCTGAAGATCGCCTACCAC GCCCACCAGGACTTTACACAGCCT GCGCTACTGTGCCATCGTCAA TGGTCATCAGCCAGACCCCCA ACGCTACTGGGGTGTGGCCCA TGGTGGTGAGCCAGATGAAGG GTGCTGTGCTTATCGTTGCT GGCTCTGTGGAGTCCATCTT CAAAGCCAACAGGGAGAAGATGA ... PAR-2b PAR- 2a PAR- 2a PAR-2b PAR-2b ELF-1 α ELF-1 α β-actin β-actin GAPDH GAPDH 18S rRNA 18S rRNA ATCTACATGGCCAACCTGGC CAGTACAYGTTCCCGTAGAAGAA GTCCGACCTGCTCTTTGTCATCTGGA TGGACTCCCCTGAAGATTGCCTACCAC...
- 12
- 278
- 0
Identification and characterization of svp interacting proteins of short vegetative phase in arabidopsis thaliana
... genetic pathways, the floral transition is also regulated by light quality, and the thermosensory pathway that mediates the effect of ambient temperature, as well as an endogenous pathway which ... plasma membrane, and with the cell plate (Boonsirichai et al., 2003) The paralog of ARG1, ARL2 has also been shown to act in the gravity signal transduction pathway (Guan et al., 2003) The arl2 ... Jdomain proteins, atDjA5, atDjA6 and atDjA7, which are Type I J-domain proteins, are localized at the chloroplast thylakoid membrane, while three Type III J-domain proteins, atDjA25, atDjA26 and...
- 216
- 335
- 0
An evaluation of EBP material “english in economics and business” for economics and business management students in hanoi university of mining and geology
... teachability of the materials, flexibility of the materials, appeal of the materials, motivating power of the materials, impact of the materials, effectiveness in facilitating short – term learning ... potential value) of a set of learning material It involves making judgments about the effect of the materials on the people using them He also states that an evaluation is not the same as an analysis ... of the materials can be made Ways of measuring the post – use effects of materials include: tests of what has been „taught‟ by the materials; tests of what the students can do; examinations;...
- 82
- 402
- 0
A study of using english songs as a type of supplementary material in teaching listening for first year non major students of english at phuong dong university
... is hardly any change in the standard deviation of the two classes The standard deviation of 1.62912 and 1.23596 shows that though there is a shift in the mark range, the range of ability among ... the author of the song, the root of it and even the words of the song So there are no reasons for not making advantage of such a useful and potential source of teaching material 2.9.2.Challenges ... to let the students listen to different songs For example, before the arrival of Mother's Day or Father's Day, the teacher can first play a song about parents, such as STRAW HAT, FATHER AND SON...
- 39
- 1,125
- 3
Tài liệu Báo cáo khoa học: Models and mechanisms of O-O bond activation by cytochrome P450 A critical assessment of the potential role of multiple active intermediates in oxidative catalysis doc
... [68], the enzyme variant still mediated N-oxygenation of the tertiary arylamine at a rate less than half that of the wild-type-catalyzed reaction [142], so that reasonable interpretation of the data ... permit the unmasking of radical intermediates that rearrange at a rate faster than that of the recombination step [16,93] Despite the apparent predominance of the hydrogen transfer mechanism as the ... species as the predominant catalyst in a host of crucial biological oxidations, has a great deal of weight, accumulating evidence points at the participation in substrate turnover of alternative active...
- 26
- 746
- 0
Bell & Howell Information and Learning 300 North Zeeb Road, Ann Arbor, MI 48106-1346 USA 800-521-0600UMI.The Potential of Soil Survey Data in a Quantitative Evaluation of Surficial Geology Mapping in Northern Maine by Rosalia EvansThesis submitted t pptx
... stony loam Machias gravelly loam Machias gravelly loam Machias gravelly loam Madawaska fine sandy loam Madawaska fine sandy loam Madawaska fine sandy loam Made land Mapleton shaly silt loam Mapleton ... the town of Grande Isle to the town of Hamlin The two areas were delineated as the research site because they are areas that contain all four of the data sources The surface area is approximately ... CoA CoB CoC DaB EaA EaB EsB FhA FhB HaA HaB HoA HoB HoC HvB HvC MaA MaB MaC MbA MbB MbC Md MhB MhC MhD Mn MoA MoB MrB Allagash Allagash Allagash Allagash Canadaigua silt loam, thin solum Caribou...
- 131
- 599
- 0
Báo cáo khoa học: Critical roles of Leu99 and Leu115 at the heme distal side in auto-oxidation and the redox potential of a hemeregulated phosphodiesterase from Escherichia coli pptx
... electronic states of Leu mutants of Ec DOS N Yokota et al (Table 3) In addition, the rate of auto-oxidation for L99F was fast but comparable to that of the L115F mutant (Table 2) The high rate constant ... 5¢-gatgagtcgggagTTTcag ctggagaaaaaag-3¢, 5¢-ggacccgttttgcgACCtcgaaagtgagc-3¢, and 5¢-ggacccgttttgcgTTTtcgaaagtgagc-3¢ Preparation of Ec DosH The (His)6-tagged Ec DosH proteins (wild-type and ... states of Leu mutants of Ec DOS N Yokota et al Sato A, Sasakura Y, Sugiyama S, Sagami I, Shimizu T, Mizutani Y & Kitagawa T (2002) Stationary and timeresolved resonance Raman spectra of His77 and...
- 14
- 390
- 0
Báo cáo khoa học: Structure and potential C-terminal dimerization of a recombinant mutant of surfactant-associated protein C in chloroform/methanol ppt
... cross-peaks was used for a conservative estimation of the maximum distances and classification of cross-peaks as weak, medium and strong For the calibration of the intensities of the NOE peaks, a statistical ... the same batch A closer look at the acquired spectra indicates a dependence of the relative population of the signals on the overall SP-C concentration As a consequence, we acquired a set of 2D ... trimethylsilane The residual water signal and the signal of the hydroxy proton of CD3OH are degenerate at 4.8 p.p.m and were reduced using presaturation [10] Before Fourier transformation, the time domain...
- 10
- 426
- 0
báo cáo hóa học: " Topological confinement in an antisymmetric potential in bilayer graphene in the presence of a magnetic field" pptx
... perpendicular external magnetic field, both for the case of a single potential kink, as well as for a kink-antikink pair One advantage of such a setup is the fact that in an experimental realization of ... presence of magnetic field (blue solid curves in panels (a, b)) The inset of panel (a) indicates that the wavespinors satisfy the a1 = ϕb3 and ϕb1 = − a3 relations at ky = and B0 = which leads to a ... obtained the spectrum of electronic bound states that are localized at potential kinks in bilayer graphene, which can be created by antisymmetric gate potentials For a single potential kink, the...
- 10
- 471
- 0
Báo cáo lâm nghiệp: "Production potential and ecological stability of mixed forest stands in uplands – VI. A beech/larch stand on a mesotrophic site of the Křtiny Training Forest Enterprise" pot
... to the dominant stand and the volume of dead trees is not included in the calculation Stand density was calculated according to standard mensurational practice from the ratio of actual basal area ... the period of evaluation The calculated very low or low stocking of the stand at an age of 25 to 35 years (0.71–0.93) was inaccurate, not corresponding to reality At that time, a large part of ... 7) are markedly lower than in larch (Tables and 6) Stand basal area It was already stated in previous papers (Kantor, Pařík 1998; Kantor, Hurt 2003) that the basal area increment dynamics was the...
- 15
- 377
- 0
Báo cáo y học: "Serum IL-15 in patients with early systemic sclerosis: a potential novel marker of lung disease" potx
... patient database, and participated in the statistical analysis and in the interpretation of the data FAW participated in the study design, was involved in the revision of the manuscript and provided ... important intellectual content AS participated in the design and coordination of the study, in the interpretation of the data and in the revision of manuscript AA participated in the design and ... coordination of the study, in the interpretation of the data and in the revision the manuscript All authors read and approved the final manuscript Acknowledgements The authors are grateful to Dr Jan-Åke...
- 9
- 419
- 0
Báo cáo y học: " Masitinib in the treatment of active rheumatoid arthritis: results of a multicentre, open-label, dose-ranging, phase 2a study" pdf
... conception and design and to analysis and interpretation of the data CDM, a medical writer at AB Science, contributed to data analysis and interpretation and was the main contributor in the preparation ... treatment of DMARDrefractory active RA Materials and methods Patients Patients from 18 to 75 years of age who had been diagnosed with active RA, according to the American College of Rheumatology ... imatinib: a study of the European Organisation for Research and Treatment of Cancer, the Italian Sarcoma Group, and the Australasian Gastro-Intestinal Trials Group (EORTC-ISG-AGITG) Eur J Cancer...
- 12
- 471
- 0
A potential protective effect of α-tocopherol on vascular complication in spinal cord reperfusion injury in rats pptx
... 37°C and 38°C by a thermal pad and a heating lamp The femoral artery was cannulated with a 22-gauge PE catheter, which was used to monitor distal arterial pressure (DAP) and for intra-arterial ... laparotomy without clamping of the aorta; IRI rats were subjected to laparotomy and clamping the aorta by non-traumatic vascular clamp just above the bifurcation for 45 min, then the clamp was ... tetrazolium (NBT) The reaction was started by the addition of NADH, incubated at 30°C and stopped by the addition of ml of glacial acetic acid The absorbance of the chromogen formed was measured at 560...
- 9
- 240
- 0
Báo cáo y học: "Anti-inflammatory potential of a malleable matrix composed of fermented whey proteins and lactic acid bacteria in an atopic dermatitis model" pot
... statistical analysis and drafted the manuscript CD participated in the design of animal studies, data interpretation and the statistical analysis CD revised the manuscript for the intellectual content ... content and language PL participated in the design of animal studies, data interpretation and revised the manuscript for the intellectual content and language All authors read and approved the final ... on Animal Care as specified in the Guide to the Care and Use of Experimental Animals (CISAU # 0306-01 and # 0410-01) Mouse atopic contact dermatitis (ACD) After a week adaptation in the animal...
- 10
- 416
- 0
báo cáo khoa học: "Healthy lifestyle behaviour among Ghanaian adults in the phase of a health policy change" pdf
... physical activity that lasted for at least 10 minutes in the last days preceding the survey In the multivariate model the index was treated as a continuous linear variable At the bivariate stage of ... dietary practices and mother and child care practices that would help eliminate the many diseases that impact on the health and well-being of Ghanaians The concept of regenerative health and ... electronic media serves as a means of reaching the population with the messages of the program In this paper the authors compare the prevalence of unhealthy lifestyle behaviours among Ghanaian adults...
- 9
- 408
- 0
Báo cáo y học: " Failure of a non-authorized copy product to maintain response achieved with imatinib in a patient with chronic phase chronic myeloid leukemia: a case report" ppsx
... escalation of imatinib has been documented in patients with poor initial response or Table Hematologic parameters at baseline, following change to imatib and return to imatinib therapy Laboratory ... consisting of the alpha crystal form of imatinib, has become commercially available under the name ‘imatib’ (CIPLA-India) at a markedly reduced price The lower price has prompted some health-care authorities ... resumed imatinib at a daily dose of 600 mg per day In July 2007, after approximately two months of therapy with imatinib, laboratory values revealed a return to a full hematologic and cytogenetic...
- 3
- 209
- 0
báo cáo khoa học: " Exploring transcriptional signalling mediated by OsWRKY13, a potential regulator of multiple physiological processes in rice" pdf
... contributed to data interpretation and to writing the manuscript All authors read and approved the final manuscript Additional material Additional file Primers for quantitative RT-PCR analysis The ... promoters of downregulated genes in vitro, suggesting that it may function more as a negative transcriptional regulator Methods Microarray data The microarray data, generated using Affymetrix ... (5'-GGGGACCACTTTGTACAAGAAAGCTGGGTTGAACACGACGGCGCACTC-3') contained attB2 site (in bold), was inserted into the pHELLSGATE2 vector by BP and LR reactions (Gateway Kit, Invitrogen, USA) Agrobacterium-mediated...
- 12
- 182
- 0
Báo cáo y học: " Activation of tumor necrosis factor receptor 1 in airway smooth muscle: a potential pathway that modulates bronchial hyper-responsiveness in asthma?" ppsx
... R, Acosta JA, Savage JM, Palakurthi SS, Halperin JA: Depletion of intracellular Ca2+ stores, phosphorylation of eIF 2a, and sustained inhibition of translation initiation mediate the anti-cancer ... protein synthesis by acting at the level of translation initiation through the inactivation of the translation initiation factor eIF2α [30,31] Additional studies support the notion that thapsigargin-sensitive ... Conclusion Characterization of the cellular and biochemical events that regulate ASM function will likely lead to new therapeutic approaches in the management of asthma In ASM cells, activation of TNFR1...
- 5
- 223
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu