... envision an aiding tool for agents to increase agent effectiveness and an administrative tool for agent appraisal and training Organization of the paper: We start by describing related work in relevant ... handling of calls to improve customer satisfaction as well as to reduce call handling time, (2) an administrative tool for agent appraisal and training Agent aiding is done based on the automatically ... performance based on manual processing of the calls The framework presented in this paper, allows alarge part of this work to be automated A domain specific model that is automatically learnt and...
... effective in sub-Saharan Africa A randomized trial in Uganda [59] comparing home-based and facility-based care also found similar rates of viral load suppression, failure and mortality A community-based ... ensure an enabling regulatory framework, and adequate training and financing [80] In conclusion, our literature review finds that task shifting is a viable and rapid response to sub-Saharan Africa's ... Kamoto K, Harries A: Nurses and medical assistants taking charge: task-shifting HIV care and HAART initiation in resource-constrained and rural Malawi Oral Abstract Session: AIDS 2008 - XVII International...
... Motivated by the work of Combettes and Hirstoaga 34 ina Hilbert space and Takahashi and Zembayashi 33 ina Banach space, Zhang 35 and also authors of 36 obtained the following lemma Lemma 2.2 see 35 ... integrals,” Journal of Mathematical Analysis and Applications, vol 305, no 1, pp 227–239, 2005 39 S Reich, “Asymptotic behavior of contractions in Banach spaces,” Journal of Mathematical Analysis and ... for resolvents of accretive operators in Banach spaces,” Journal of Mathematical Analysis and Applications, vol 75, no 1, pp 287–292, 1980 30 P Katchang and P Kumam, “An iterative algorithm for...
... he joined France Telecom, a research department in France, where he was engaged in research on echo cancellation and adaptive filtering He has also served as a Teaching Assistant in several courses ... is an Associate Researcher in the Image and Signal Processing Team (ETIS), ENSEA, Cergy-Pontoise His current research interests include adaptive filtering, linear and nonlinear channel equalization, ... Gi can be selected in various ways For example, the mean values establish a grid in the region of the state space that contains the probability mass The αi are chosen as the values p(ai ) of the...
... 16-bit TIFF images of Cy3 and Cy5 signal intensities The images were analyzed using GenePix Pro 3.0 microarray analysis software to measure fluorescence signals and format data for database deposition ... following additional data files are available with the online version of this article and also at the authors' website [66]: an Excel table (Additional data file 1) of all redundant microarray probes ... 5'-TCCTTAAAGCTGCTGCACTTCCC-3'; somatostatin forward GGCTTTGG-3'; primer 5'-TGCATCGTCCT- somatostatin reverse primer 5'-GAGTTAAGGAAGAGATATGGG-3'; tenascin C forward primer 5'-TTCGTGTGTTCGCCATCTTG3';...
... to the inserted cDNA fragment the “canonical adaptor region” (5’TTGTAAAACGACGGCCAGTGAATTGTAATACG ACTCACTATAGGGCGAATTGGGTACCGGG CCCCCCCTCGAGGTATAAGCTTGATATCGAAT TCCGTTGCTGTCG-3’), “2variant39” ... tables, and wrote the initial manuscript draft AE performed all root EST sequencing, primary data analysis and submission RLA performed all root tissue preparations and mRNA extractions and data analyses ... cgi?ORG=Vvi&LID=22274[85] Datasets used, clustering analysis and annotation All available V vinifera sequences (including ESTs, expressed transcripts as well as other available DNA sequences in the NCBI database) were...
... label all the other instances extracted form the AQUAINT We call all these labeled instances artificially labeled training instances 33 After extracting the artificially labeled training instances ... of data available to the public, making even more people aware of the problems involved in handling this quantity of data Managing Gigabytes When handling such huge volumes of data (like AQUAINT), ... (WSD) has many applications 1.1.2 Application of WSD WSD is a fundamental problem for natural language understanding It is also a very important part in natural language processing applications...
... interface and gradually migrate into the aqueous phase Finally, an entangled mat of PANI fibers can be filtered and collected The fast mixing approach in an all aqueous media was discovered later, ... non-ionic surfactants.24 Moreover, some oxidants can assist surfactants in soft templates formation For example, insoluble lamellar precipitate as a soft template can be formed by adding both ammonium ... higher miniaturization but instead a discovery ofa wealth of novel physical, chemical and biological behaviors on the nano-scale However, fabrication of nanomaterials is absolutely essential to any...
... Three Page 48: The examiner comments that the two paragraphs in 3.1 are ‘repeated’ Reply: not changed Explanation: The paragraphs in 3.1 give an introduction of chemical synthesis methods for PANI ... (CTAB) in Chapter Two; other chemicals remain the same Page 52: The examiner comments that the paragraph in 3.2.4 is ‘repeated’ Reply: not changed Explanation: The characterization methods are ... delocalization degree in PANI Page 42: The examiner questions ‘why the strong peak centered at about 950 nm with a free-carrier tail extending into the near-infrared region is and indication PANI...
... TTG TAC AAA AAA GCA GGC TTC GAA GGA GAT AGA ACC ATG GCT ATC TCT GGC GAT AGT-3’ 5’-GGGG AC CAC TTT GTA CAA GAA AGC TGG GTC CTG CAG tta ctt gta cag-3’ pTWIN1-ECFP-NLS and pT-Rex-DEST30-intein/ECFP-NLS ... protein microarray technologies for large- scale protein analysis and live cell bioimaging In the first application for live cell bioimaging, a protein of interest having an Nterminal cysteine was ... allows for the insertion ofa cysteine residue (codon TGC) after the last amino acid of the intein, asparginine (codon AAC) Upon intein cleavage, the target protein will have an N-terminal Cys...
... of them have similar shape and the result is the gathering of oils in Cat Hai area and Bach Dang estuary Figure shows diagrams of distribution of particulate concentration in water at depth of ... central and north - east region The deposition of the SPM at the bottom is more in the area near Ha Long, Bai Chay and Cat Ba coasts than it is in the central area The seasonal variation of SPM ... models also allow to integrate with models of ecological components and water quality, therefore open up the application in monitoring and forecasting coastal and marine environment 68 Dinh Van...
... Country Age and duration of primary and secondary education Australia Austria Belgium Canada Chile Czech Rep Denmark England Estonia Finland France Germany Greece Hungary Iceland Ireland Italy Israel ... continuing training for teachers Again, according to TALIS, while most teachers have had initial teacher preparation, many still feel that they want more professional development On average across TALIS ... feeling incapable ofa given task The lack of motivation may also come from their belief that they not have what it takes for high levels of learning, causing also a decline in self-esteem Also,...
... fewer actual observations, and less detailed simulated information and an increased number of actual observations Since the value from actual transitions has a higher accuracy than the simulated ... Many welfare benefits in Ireland are flat rate based and are not earnings related (Evans et al., 2000; Callan, 1997) Ireland has a set of categorical instruments, covering contingencies such as ... standard of living Analysing the retirement income based solely on the official status may introduce a bias towards the living standard of the retirees as this is a mixed group containing also...
... screening Indian J Med Res: 1976; 64, 1150-1159 Gopi PG, Subramani R, Radhakrishna S, Kolappan C, Sadacharam K, Devi TS, Freiden TR, Narayanan PR A base line survey of the prevalence of tuberculosis in ... Krishnamacharya L, Devan J, Ponnusamy R, Komaleeswaran G and Prabhakar R A Tuberculosis prevalence survey based on Symptoms questioning and sputum examination Indian J Tuberc 1997; 44: 171-180 Datta ... cough against chest pain for screening the population was reported by Gothi et al and Baily et al11 The contribution of fever alone (without cough and chest pain) in identifying Indian Journal of...
... fruit and intercrops such as mulberry, sugar cane, mandarin 3.4 Characteristics of sandy soil class Sandy soil class including white sandy soil and marine sandy soil type from the interaction of ... and aquaculture Low and high saline soils are mainly for growing rice Rice grown in moderate and low saline soils has been of good quality and high yield Recently, suitable saline soil in Thai ... of sea, river, field current flow and wind This kind of soil is distributed along the coast bank and sand dunes with an area of about 726.63 (2.6% of the total area of the district), mainly in...
... information to textual data Birgit Hamp and Helmut Feldweg 1997 Germanet - a lexical-semantic net for german InIn Proceedings of ACL workshop Automatic Information Extraction and Building of ... resources including English, German and Latin In this module, not only co-occurrence data, social and terminological ontologies but also social tagging enhanced data are available fora given input token ... teams: One team collects data from field research, a second processes and annotates the raw data and a third team performs statistical analysisIn this example every group has the need to share...
... filtering of the same data Materials and methods The BF A BF W consists ofa product of two separate filters, one acting in the spatial domain (WS), one acting in the intensity domain (W I ) Choosing ... best of our knowledge, performance of bilateral filtering in the PET image domain has not yet been systematically evaluated In this study, we investigated bilateral filtering of PET image data with ... allows to increase the SNR of PET image data while preserving spatial resolution at object boundaries, thus maintaining the quantitative accuracy of SUVmax values even in small lesions Therefore,...
... and E Yanagida, “Minimization of the principal eigenvalue for an elliptic boundary value problem with indefinite weight, and applications to population dynamics,” Japan Journal of Industrial and ... weak topology and extremal problems of eigenvalues of the p-Laplacian,” to appear in Transactions of the American Mathematical Society 11 M Zhang, “Extremal values of smallest eigenvalues of ... Li and P Yan, “Various half-eigenvalues of scalar p-Laplacian with indefinite integrable weights,” Abstract and Applied Analysis, vol 2009, Article ID 109757, 27 pages, 2009 G Meng, P Yan, and...
... consists ofa comparison of ISAR images obtained from the same data by means of the deterministic and genetic algorithms The ISAR images relative to the Boeing 737 data, obtained by means of the GA and ... 1185–1191, 1996 [6] M Martorella, B Haywood, F Berizzi, and E Dalle Mese, “Performance analysisof an ISAR contrast based autofocusing algorithm using real data,” in Proceedings of IEE Radar Conference, ... The GA replaces both the estimation of the initial guess and the final focusing parameters In fact, GAs not need an initial guess This may represent an additional advantage because the performance...
... role of leaf water status in explaining the afternoon depression ofAina range ofspeciesof the temperate zone In fact, the diurnal changes inAin the J copaia leaflets were clearly related ... exception of leaflet 12, E falcata was characterized by daily changes inA being in close relationship with those in /p, while J copaia exhibited a diurnal pattern with a clear depression ofA during ... J copaia This might be of major importance for the choice of appropriate speciesfor reforestation References Doley D., Yates D.J & Unwin G.L (1987) Photosynthesis in an Australian rain forest...