functional explanation in biology and a corresponding account in morality
Tài liệu Báo cáo khoa học: "TREATMENT OF LONG DISTANCE DEPENDENCIES IN LFG AND TAG: FUNCTIONAL UNCERTAINTY IN LFG IS A COROLLARY IN TAG" ppt
... treat it as a variable that gets instantiated on adjoining This treatment can be formalized by treating the auxiliary trees as functions over feature structures (by A- abstracting the variable corresponding ... the same as that made by the functional uncertainty machinery 4.1 INTERACTIONS AMONG UNCERTAINTY EQUATIONS The functional uncertainty machinery is a means by which infinite disjunctions can be ... introducing graph adjoining grammars which generate exactly the same languages as TAGs In a graph adjoining grammar, /~x is represented as shown in Figure Notice that in this representation the...
- 8
- 608
- 0
Diagnosis of pulmonary tuberculosis by smear microscopy and culture in a tertiary health care facility: Biology and Medicine docx
... of Science, Jazan University, Jazan, Kingdom of Saudi Arabia *Corresponding Author: kismail@jazanu.edu.sa, sayeedkhatib@hotmail.com Abstract Smear microscopy and culture forms the backbone of tuberculosis ... being achieved Passive case finding is the mainstay of case finding in most developing countries This relies heavily on sputum examination by smear and culture, chest radiology and tuberculin ... (TB) laboratory investigations in tertiary healthcare facilities which have a large number of cases and financial constraints The present study aimed to re-evaluate the efficiency of smear microscopy...
- 6
- 465
- 0
Báo cáo khoa học: Chromophore attachment in phycocyanin Functional amino acids of phycocyanobilin – a-phycocyanin lyase and evidence for chromophore binding doc
... CGGGCAAATGACAGCAGCTGTA-3¢, upstream; P10: 5¢-AAACCCGGGCGCAGTGTAGCTGAAG-3¢, upstream; P11: 5¢-CCCCTCGAGCCCTTAAATTGGTTGTTGTA-3¢, downstream; P12: 5¢-ATACCCGGGATGACTGCCACTA CTCAACAATTAAAACGT-3¢, upstream; ... upstream; P2: 5¢-GGGCTCGAGCGGCAATTAAAGTGG GAAT-3¢, downstream; P3: 5¢-ATACCCGGGATACTCCT GACCATGACTGC-3¢, upstream; P4: 5¢-ACCCTCGAGT TATCTTGAGAGTGGAACAAA-3¢, downstream; P5: 5¢-ATGCCCGGGGGTAAGTTTCGCGTTCG-3¢, ... upstream; P6: 5¢-GGGCTCGAGTTACATCAAATTCATGACTCG-3¢, downstream; P7: 5¢-CCCCTCGAGCTTGCTACAATTAT GAATCCA-3¢, downstream; P8: 5¢-ACCCTCGAGTTATT TTCTACCTTGGCCAGC-3¢, downstream; P9: 5¢-TGTCC CGGGCAAATGACAGCAGCTGTA-3¢,...
- 13
- 436
- 0
báo cáo hóa học:" Relationships between post operative pain management and short term functional mobility in total knee arthroplasty patients with a femoral nerve catheter: A preliminary study" doc
... blockade, oral and intramuscular (IMI) narcotic and non narcotic analgesics [4] Although IV narcotic PCA has been shown to be more effective than IMI and oral narcotic analgesia, and has the advantage ... Demographic data and data on daily CPM, pain and nausea scores and type and doses of analgesia, local anaesthetic and anti-emetics received were collected from the patient’s medical record, in addition ... reported as mean and standard deviation (SD) or median and interquartile range (IQR) according to normality As data were mixed in regard to normality a Mann Whitney U test was used to compare data from...
- 8
- 472
- 0
báo cáo hóa học:" Relationships between post operative pain management and short term functional mobility in total knee arthroplasty patients with a femoral nerve catheter: A preliminary study" pdf
... blockade, oral and intramuscular (IMI) narcotic and non narcotic analgesics [4] Although IV narcotic PCA has been shown to be more effective than IMI and oral narcotic analgesia, and has the advantage ... Demographic data and data on daily CPM, pain and nausea scores and type and doses of analgesia, local anaesthetic and anti-emetics received were collected from the patient’s medical record, in addition ... reported as mean and standard deviation (SD) or median and interquartile range (IQR) according to normality As data were mixed in regard to normality a Mann Whitney U test was used to compare data from...
- 8
- 429
- 0
Báo cáo hóa học: "Research Article ´ A Functional Equation of Aczel and Chung in Generalized Functions" pdf
... K Sahoo, and S Xie, “On a distributional analog of a sum form functional equation,” Acta Mathematica Hungarica, vol 78, no 4, pp 333–344, 1998 E Deeba and S Xie, “Distributional analog of a functional ... Applied Mathematics Letters, vol 21, no 7, pp 694–700, 2008 14 P Nakmahachalasint, “On the generalized Ulam-Gavruta-Rassias stability of mixed-type linear and Euler-Lagrange-Rassias functional ... in Advances in Equations and Inequalities, Hadronic Mathematics, pp 67–71, Hadronic Press, Palm Harbor, Fla, USA, 1999 11 S.-M Jung and J M Rassias, “Stability of general Newton functional equations...
- 11
- 317
- 0
Báo cáo lâm nghiệp: "Morphological and functional variability in the root system of Quercus ilex L. subject to confinement: consequences for afforestation" ppt
... and MT, indicating that lower flows were obtained in ST for a particular pressure value KRL and KRR (Fig 3) had significantly lower values in ST as compared with LT and MT In particular, KRL was ... 22) AR and VR were about 38% and 88% higher, respectively, in LT than in ST, whereas DR was about 50% higher in ST than in LT and DRW was about 50% higher in LT and ST than in MT Besides, LR was ... in each container type according to a completely randomized design and using one seed per container Seedlings were kept well watered during the growing period and were cultivated in a shade house...
- 6
- 371
- 0
Báo cáo y học: "Biology of recently discovered cytokines: Interleukin-17 – a unique inflammatory cytokine with roles in bone biology and arthrits" pdf
... 11:2044-2055 Takaya H, Andoh A, Makino J, Shimada M, Tasaki K, Araki Y, Bamba S, Hata K, Fujiyama Y, Bamba T: Interleukin-17 stimulates chemokine (interleukin-8 and monocyte chemoattractant protein-1) ... destruction in adjuvant arthritis through osteoprotegerin ligand Nature 1999, 402:304-309 Nakashima T, Kobayashi Y, Yamasaki S, Kawakami A, Eguchi K, Sasaki H, Sakai H: Protein expression and functional ... MAPK, protein kinase A and JAK/STAT (Janus kinase/signal transducer and activator of transcription) pathways (for review [8]) However, only in a few cases have these pathways been linked to specific...
- 8
- 384
- 0
Báo cáo y học: "Association of functional variants of PTPN22 and tp53 in psoriatic arthritis: a case-control study" docx
... Toronto Informed consent was obtained from all patients All PsA probands were Caucasians Information was collected systematically and included age at onset of psoriasis and PsA, and disease pattern ... mean age at onset of the study was 49.7 years The mean age at onset of psoriasis was 29.3 years (standard deviation 14.2 years) and the mean age at onset of PsA was 38.1 years (standard deviation ... deviation 11.3 years) The mean age at onset of psoriasis was 26.8 years (standard deviation 12.1 years) and the mean age at onset of PsA was 33.0 years (standard deviation 10.8 years) Forty-four...
- 3
- 324
- 0
báo cáo khoa học: " Analysis of expressed sequence tags from a single wheat cultivar facilitates interpretation of tandem mass spectrometry data and discrimination of gamma gliadin proteins that may play different functional roles in flour" ppt
... authors thank Drs Ann Blechl and Olin Anderson for critical reading of the manuscript and Stacia Sloane for assistance in data analysis This research was funded by USDA Agricultural Research Service ... this article as: Altenbach et al.: Analysis of expressed sequence tags from a single wheat cultivar facilitates interpretation of tandem mass spectrometry data and discrimination of gamma gliadin ... proteins and the number and arrangement of cysteine residues within proteins of each gliadin subgroup also are distinct Alpha gliadins contain conserved cysteine residues that form three intrachain...
- 14
- 325
- 0
Báo cáo y học: " Factor correction as a tool to eliminate between-session variation in replicate experiments: application to molecular biology and retrovirology" ppsx
... Mean (and SEM) of the data of the molecular -biology data set from Figure A: original data B: normalised data C: standardised data D: data after factor correction Note that normalisation, standardisation, ... Comparison of normalisation, standardisation and factor corComparison of normalisation, standardisation and factor correction DNA constructs containing different enhancer, promoter, and intron ... means among each other Note that in this approach part of the variation in the data set is attributed to a variation in factor effect within a session This is in contrast to the above ratio approach...
- 8
- 304
- 0
Báo cáo y học: "Comparative genomics reveals a constant rate of origination and convergent acquisition of functional retrogenes in Drosophila" pptx
... our final dataset listed in Additional data file Additional data files The following additional data are available with the online version of this paper Additional data file is a table listing ... mauritiana and D sechellia) [3] on chromosomal arm 2L It seems to have given rise to a retrogene in the D ananassae lineage and another independent retrogene originated in the lineage of D grimshawi ... also originated in the lineages leading to D yakuba and D erecta and this occurred independently in the three instances (Additional data file 7, Figure 2) This is one example of parallel recruitment...
- 9
- 406
- 0
Identification and characterization of protein kinase CK2 as a novel interacting protein of neuronal CDK5 kinase and its functional role in microtubule dynamics
... VI Abbreviations a. a amino acid AD Alzheimer’s disease APP amyloid precursor protein ATP adenosine triphosphate c-abl c-Abelson CAK Cdk activating kinase CaMKII Ca2+/calmodulin-dependent protein ... et al., 2002; Miyata and Yahara, 1995) Studies have demonstrated that CK2 also interacts with other 11 proteins, such as tubulin and FAS-associated factor 1, that may be involved in the targeting ... of Cdk family share greater than 40% sequence identity and have a cyclin-binding and -activating domain (Morgan, 1995) The typical Cdk subunit contains a 300 amino acid catalytic core that is completely...
- 182
- 480
- 0
Ant functional group succession dynamics correlates with the age of vegetation succession data analysis of worldwide studies and a case study of a secondary tropical rain forest in singapore
... Australia Kununurra, Australia Vicosa, Brazil Mkomazi Game Reserve, Tanzania Popondetta, Papua New Guinea Sarapiqui, Costa Rica Catanduanes Island, The Philippines Dimona and Porto Alegre, Brazil ... Nature Reserve, South Africa Western Ghats, India Kinabalu National Park, Borneo Riviere Bleue, New Caledonia Barro Colorado Island, Panama Barro Colorado Island, Panama Atherton Tablelands, Australia ... observation that ants and vascular plants have ecological parallels (Andersen, 1991) Vascular plants generally have similar ecological requirements and strategies in that individuals are situated in...
- 109
- 536
- 0
Calculations for Molecular Biology and Biotechnology A Guide to Mathematics in the Laboratory 2nd Edition
... Labeling - Percent Incorporation 6.4.2 Random Primer Labeling - Calculating Theoretical Yield 6.4.3 Random Primer Labeling - Calculating Actual Yield 6.4.4 Random Primer Labeling - Calculating ... Concentration of Double-Stranded DNA (dsDNA) 5.2.1 Using Absorbance and an Extinction Coefficient to Calculate Double-Stranded DNA (dsDNA) Concentration 5.2.2 Calculating DNA Concentration as a Millimolar ... Calculations for Molecular Biology and Biotechnology To my parents Mary and Dude and to my wife Laurie and my beautiful daughter Myla Calculations for Molecular Biology and Biotechnology A...
- 519
- 873
- 0
In order to become competent in a foreign language, it is important for language learners not only to acquire new vocabularies and a new set of phonological and syntactic rules but also to learn what Wilson (1986)
... Long An, Tiền Giang, An -18- Giang, Kiên Giang, Cà Mau, Sóc Trăng, Bạc Liêu, Đồng Tháp, Bến Tre, Hậu Giang, Vónh Long, Trà Vinh thành phố Cần Thơ Vò trí đ a lí Nam Bộ: ph a bắc tây - bắc giáp Cam-pu-chia, ... ngữ Nam Bộ Như vậy, không gian đ a lí tiếng miền Nam, phương ngữ miền Nam hay phương ngữ Nam tác giả xác đònh rộng Không gian đ a lí phương ngữ Nam Bộ xác đònh hẹp Ranh giới PNNB trùng với ranh ... (từ thû ấy/ đến nay), thû (từ thû ấy/ đến giờ) V a rút gọn v a đảo trật tự câu nghi vấn tính chất, đặc điểm: bao cao (cao bao nhiêu), bao dai (dài bao nhiêu), bao lớn (lớn bao nhiêu)… Rút gọn,...
- 137
- 853
- 0
english adjective antonyms and a contrative analysis with those in vietnamese
... learning English III.1 Application We can apply adjective antonyms in teaching and learning vocabulary, grammar and writing, reading III.1.1 Vocabulary There are too many adjective antonyms in ... applied in teaching and learning vocabulary but also in writing and grammar To teach grammar, teacher gives structures and then let pupils give examples by using adjectives We only replace the adjectives ... have based myself on three main methods IV.1.Analytical method: Analysing materials IV.2.Synthetic method : Synthesising materials, classifying them in a typical way and finding out the suitable...
- 55
- 1,105
- 16
Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt
... TAG AGC AGG GTA GGT TGA TTT CAT GTC GAA TG-3¢; additional XbaI site underlined) and OB (5¢-AAA AGA ATT CTT AGA AGT CCC AGT CAT CGT C-3¢; additional EcoRI site underlined) The amplified PCR fragment ... was used as internal standard for all measurements For GF-AAS measurements, an AAS5 EA system (Carl Zeiss GmbH, Jena, Germany) was used Manganese was determined at a wavelength of 279.8 nm and ... mini-gel system (Biometra GmbH, Gottingen, Germany) Coomassie stained protein ¨ bands were compared with protein molecular weight standards (Amersham Pharmacia, Piscataway, NJ, USA) Polyclonal...
- 14
- 872
- 0
Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx
... mitochondrial Peroxiredoxin Annexin A5 Annexin A2 Aldolase A Fascin Pyruvate kinase VDAC-2 Stathmin Ran1BP GSTp C1qBP Profilin Enolase RuvB-like CRMP4 Lamin A ⁄ C Mitofilin, p32 GAPDH ATP synthase a P05387 ... eukaryotic initiation factor 5A (eIF 5A) , parathymosin, L7 ⁄ L12, annexin A2 , annexin A5 , aldolase A, fascin and peroxyredoxin 1] displayed quantitative differences, regardless of whether or not a- synuclein ... (Stratagene, Santa Clara, CA, USA) (150 ngÆwell)1) and phRL-CMV, containing Renilla luciferase cDNA (5 ngÆwell)1), using Lipofectamine and OptiMEM medium (Invitrogen, Carlsbad, CA, USA) In pNF-jB-Luc...
- 11
- 775
- 0
Tài liệu Báo cáo khoa học: How disorder influences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx
... N-terminus was obtained by PCR from the plasmid pET21 SIC1 [32] with a forward primer (5Â-TAC CTGGCCAATGAATATGCATCATCATCATCATCATA CTCCGTCGACCCCACC-3Â) designed to introduce a hexahistidine tag and ... hexahistidine tag was obtained by PCR using the pET2 1a PNT-H6 plasmid [30] as the template The forward primer (5Â-TACCGTTAACATCGATATGCATCATCATC ATCATCATGC-3Â) was designed to insert a ClaI restriction ... 5Â-GGCTGCAAGCAATGGCAGG-3Â) that introduced the same silent mutation as above at nucleotide position 321 and a reverse primer (REVN2: 5Â-ATCGCC ATGGTCCCGGGCATATGGGATCCCTGGAAGTACA GGTTTTCGTCTAGAAGATTTCTGTC-3Â)...
- 14
- 672
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ