functional assessment of amino acid variation caused by single nucleotide polymorphisms a structural view
Báo cáo khoa học: Weak organic acid stress inhibits aromatic amino acid uptake by yeast, causing a strong influence of amino acid auxotrophies on the phenotypes of membrane transporter mutants ppt
... organic acid stress Auxotrophic requirements for aromatic amino acids dramatically increase sensitivity to weak organic acid stress, a sensitivity suppressed by amino acid supplementation Platings of ... to catalyse uptake of aromatic amino acids from the medium Probably this is due to the weak organic acid exerting a strong inhibition of the activity of the Tat2p amino acid permease, though this ... Viegas, C .A & Correia, I (2000) Expression of the AZR1 gene (ORF YGR224w), encoding a plasma membrane transporter of the major facilitator superfamily, is required for adaptation to acetic acid and...
- 7
- 391
- 0
Tài liệu THE ROLES OF AMINO ACID CHELATES IN ANIMAL NUTRITION pdf
... METABOLISM OF METAL AMINO ACID CHELATES AND INORGANIC METAL SALTS H DeWayne Ashmead INCREASING INTESTINAL DISACCHARIDASE ACTIVITY IN THE SMALL INTESTINE WITH AMINO ACID CHELATES Silvano Maletto ... Station Lake Hamanako Branch Shizuoka, Japan XVII Takatsuka, Takeharu Shizuoka Prefectural Fisheries Experimental Station Lake Hamanako Branch Shizuoka, Japan Volpelli, L A University of Bologna Bologna, ... W Hardy and Karl D Shearer THE EFFECTS OF IRON AMINO ACID CHELATE IN CULTURE EELS Katsuhiro Suzuki, Yoshito Iwahasi, Takeharu Takatsuka and Takaaki Wakabayashi 413 424 440 SECTION SUMMARY AND...
- 502
- 2,529
- 1
Báo cáo Y học: Functional studies of the Synechocystis phycobilisomes organization by high performance liquid chromatography on line with a mass spectrometer docx
... environmental factors such as UV radiation and physiological stress such as starvation may affect this supraorganization are also presented MATERIALS AND METHODS Chemicals Reagent-grade phosphoric acid, ... b-phycocyanins, but not of allophycocyanins which also contain bilins [28] Because it is difficult to attribute the specific damage to variations in aromatic amino- acid content, because the amino- acid ... composition and supramooptical decreases observed could be correlated to the lecular organization of phycobilisomes and may increase the damage of aromatic amino acids, this could not explain understanding...
- 9
- 477
- 0
Báo cáo khoa học: Optimization of D-amino acid oxidase for low substrate concentrations – towards a cancer enzyme therapy pdf
... yeast DAAO variants with substantially increased activity at low O2 and d -amino acid concentrations This could lead to better efficacy in therapeutic applications Results Selection of DAAO variants ... DAAO and ⁄ or d-Ala addition) was taken as 100% of survival Toxicity was quantified as the fraction of surviving cells relative to the untreated cells as control Oxygen reactivity of D -amino acid ... such as those reported in (A) tive half-reaction obtained for Q144R-DAAO are identical to those of wt-DAAO, a detailed kinetic investigation of this mutant DAAO was not carried out As with wt-DAAO...
- 12
- 413
- 0
Báo cáo khoa học: Mutational analyses of human eIF5A-1 – identification of amino acid residues critical for eIF5A activity and hypusine modification doc
... different amino acids, i.e acidic, neutral and basic amino acids The fact that eIF 5A activity is impaired partially by Ala substitution and totally by Asp substitution, but not by Arg substitution, ... H5 1A, G5 2A, K5 5A, F6 4A, P7 4A, H7 7A, M7 9A, P8 2A, I8 4A, R8 6A, L9 1A, L10 1A, P11 5A, E11 6A, L11 9A, E14 4A, K15 0A, M4 3A ⁄ M7 9A, and C7 3A ⁄ M7 9A The ability of each mutant protein to complement growth of ... heIF 5A mutants, including D 3A, D 4A, L 5A, D 6A, F7W, D1 1A, G1 3A, S1 5A, T1 7A, P1 9A, C2 2A, P3 7A, C3 8A, M4 3A, K4 7A, K47D, K47R, G4 9A, K5 0A, K50D, K50I, K50R, H5 1A, G5 2A, K5 5A, F6 4A, P7 4A, H7 7A, M7 9A, ...
- 15
- 303
- 0
Báo cáo "The dependence of the nonlinear absorption coefficient of strong electromagnetic waves caused by electrons confined in rectangular quantum wires on the temperature of the system" doc
... nonlinear result will turn back to a linear result Numerical results obtained for a GaAs/GaAsAl CQW show that α depends strongly and nonlinearly on the temperature T of the system As the temperature ... the nonlinear absorption coefficient of a strong EMW for a GaAs/GaAsAl RQW The parameters of the CQW The parameters used in the numerical calculations [6,13] are ξ = 13.5 eV , ρ = 5.32 gcm −3 , ... system As the temperature increases the nonlinear absorption coefficient increases until it reached the maximum value (peak) and then it decreases At different values of the size Lx and Ly of wire...
- 6
- 414
- 2
Báo cáo Y học: The effect of amino-acid substitutions I112P, D147E and K152N in CYP11B2 on the catalytic activities of the enzyme pdf
... CCTGCAGGATGCCCCTGGAG CCTGCAGGATGAGCCTGGAG GCTGAACCCAGAAGTGCTGTCGCCC ACCCAGAAGTGCTGTCGCCCAACGCCG TGC Ó FEBS 2002 1120 S Bechtel et al (Eur J Biochem 269) Transient transfections and enzymatic assays ... from H Takemori, Department of Physiological Chemistry, Osaka University Medical School Osaka, Japan) The total amounts of protein were quantified using a BCA assay kit, according to the manufacturer’s ... a faster and easier passage of the substrate, possibly caused by a substrate access channel enlargement (Fig 5) Also, the slightly reduced oxidation activity of these constructs suggests a facilitated...
- 10
- 648
- 0
FUNCTIONAL ASSESSMENT OF THE ELDERLY pot
... is associated with an increased prevalence of visual impairment Black Americans have a rate of visual impairment almost twice the rate of white Americans From 65 years there is a steady decrease ... attention Functional Assessment Screening Instruments Functional capacity can be assessed partially by validated questionnaires and screening instruments that can be administered by trained office staff ... white Americans and glaucoma is the most frequent cause of blindness among black Americans Simple Visual Testing can be done by asking patients to read a few lines from a newspaper If a patient can...
- 14
- 363
- 0
Báo cáo khóa học: Purification and functional characterization of insecticidal sphingomyelinase C produced by Bacillus cereus ppt
... Analyzer (Applied Biosystems Japan Ltd, Tokyo, Japan) Biochemical properties of the bacterial species were analyzed using API50 CHB and API20E test kits ´ (bioMerieux Japan, Tokyo, Japan) Heat ... removed by filtration using a bottle top vacuum filtration system (Asahi Techno Glass Co., Chiba, Japan) Ammonium sulfate was further added to the filtrate to increase its concentration to 60% saturation, ... ABI3100 analyzer Functional expression of the insecticidal toxin (SMC) in E coli The SMC gene amplified by PCR using the vector sense (VS) (5¢-GGGAATTCCATATGGAAGTGTCTACAA ATC-3¢) and vector antisense...
- 6
- 456
- 0
Separation of acetic acid and water by distillation effect of calcium chloride addition
... reverse the relative volatility TABLE 111 SMOOTHED VAPOR-LIQUID EQUILIBRIUM BOIL- of acetic acid and water The reversal takes place a t about ARD ING POINT DATA FOR ACETIC ACID- WATER-CALCIUM CHLORIDE ... because of the lack of available data on the boiling points of solutions of calcium chloride in glacial acetic acid CONCLUSIONS The results confirm the observation of Quartaroli (9) that the by ... portion of a cellulose acetate washed with water containing a certain salt to the viscosity of a second portion of the same acetate washed with salt-free water or with water containing a salt known...
- 4
- 422
- 0
Báo cáo hóa học: " Dielectric Relaxation of La-Doped Zirconia Caused by Annealing Ambient" pptx
... independent of the annealing ambient PDA in air caused a negative shift of the C–V curves due to positive charge generation and also caused an enhanced accumulation capacitance, which originated from a ... relaxation of the as-deposited film obeyed a mixed CS and HN relationships After the 900°C PDA, the relaxation behavior of the N -annealed film was dominated by the CS law, whereas the air-annealed ... k-value was maintained and the dielectric relaxation was reduced However, PDA in air causes a significant increase in k-value (32 at kHz) and a significant dielectric relaxation, probably associated...
- 6
- 285
- 0
Báo cáo khoa học: "An outbreak of fatal hemorrhagic pneumonia caused by Streptococcus equi subsp. zooepidemicus in shelter dogs" pptx
... 270 Jae-Won Byun et al Briefly, primers FUS (5´-ATACAGGCTGAAATTGCAGG3´) and FDS (5´-CTTGCGAAAACCAGTTTAGG-3´) designed from se18.9 were used to amplify chromosomal o DNA in bacteria The PCR reaction ... scattered in alveolar lumen and also engulfed by alveolar macrophages (arrows) Gram stain Scale bar = 20 μm (C) Liver Bacterial clumps are infiltrated in the sinusoid Gram stain Scale bar = 50 μm (D) ... CAV-2 (USBiological, USA) and CPIV (USBiological, USA) Grossly, large amounts (50∼150 mL) of dark red fluids filled the thorax of all carcasses The lungs failed to collapse and were hemorrhagic,...
- 3
- 267
- 0
Báo cáo khoa học: "Effects of variable root damage caused by Phytophthora cinnamomi on water relations of chestnut saplings" doc
... m2) was estimated by a linear weight-surface relationship established on a sample of nine saplings (leaf area measured after digitising leaf with “DeltaT Scan” software, A T Delta-T Device, Cambridge, ... course of predawn leaf water potential (ΨLpredawn) (a, d), stomatal conductance (gs) (b, e) and whole plant transpiration (Esapling) (c, f) measured in 1999 on Castanea sativa saplings grown in a ... S.D.) Figure General plot of stomatal conductance (gs) as a function of predawn leaf water potential (ΨLpredawn) of Castanea sativa saplings inoculated with Phytophthora cinnamomi with different...
- 13
- 212
- 0
Báo cáo y học: "anagement of upper airway edema caused by hereditary angioedema" pptx
... as edema often involves the mucosa of the meso-and hypopharynx in addition Intriguingly, edema-formation spares the mucosa of the nasal cavity and of the paranasal sinuses The exact anatomical ... the term ‘laryngeal edema’ with ‘upper airway edema (UAE)’ seems more appropriate and accurate The diagnosis of UAE 3.1 Clinical manifestations and localization of UAE Recognizing airway involvement ... endotracheal intubation) Dental surgery is a leading cause, potentially associated with fatal UAE [15,22-24] Before the diagnosis of HAE is established, facial edema or UAE associated with a dental...
- 8
- 328
- 0
Báo cáo y học: "Assessment of the emotional responses produced by exposure to real food, virtual food and photographs of food in patients affected by eating disorders" ppsx
... STAI-S and the VAS -A After that, the experimental session started, and heart rate, skin conductance and respiration rate were Several within-subject repeated measure analysis of variance (ANOVA) ... averages of anorexia (AN) and bulimia nervosa (BN) groups AN, mean (SD) BN, mean (SD) Page of 10 reflects a 'transitory emotional state or condition of the human organism that is characterized by subjective, ... interpretation: high scores mean more state anxiety and low scores mean less Visual analogue scale for anxiety (VAS -A) The VAS -A [22] is a 100 mm vertical line with end points anchored as no anxiety at...
- 10
- 396
- 0
Báo cáo y học: " Detection and correction of false segmental duplications caused by genome mis-assembly" potx
... coverage, as indicated by the A- statistic, suggested that a contig was duplicated even though our analysis of mate pairs indicated that it was spurious In each case, the mated reads associated ... greater than four standard deviations away, and then estimated the parameters again 'Nonparametric' plots the actual density of mate pair distances after running a cubic smoothing spline The actual ... ED, Archidiacano N, Eichler EE: A preliminary comparative analysis of primate segmental duplications shows elevated substitution rates and a great-ape expansion of intrachromosomal duplications...
- 11
- 338
- 0
Báo cáo y học: "Assessment of HIV-1 entry inhibitors by MLV/HIV-1 pseudotyped vectors" ppt
... Onishi M, Nosaka T, Misawa K, Mui AL, Gorman D, McMahon M, Miyajima A, Kitamura T: Identification and characterization of a constitutively active STAT5 mutant that promotes cell proliferation Mol ... detected by incubation with goat antiserum against gp120 (Dunn Labtech, Ansbach, Germany) or a polyclonal antiserum directed against MLV p30 [1], followed by an incubation with a horseradish peroxidase-labeled ... MLV/HIV-1 particles was analyzed by Western blot analysis of particles concentrated from FLY cell supernatants by ultracentrifugation Equal loading was confirmed after stripping the blot and incubating...
- 6
- 235
- 0
Báo cáo y học: "Surgical management of life threatening events caused by intermittent aortic insufficiency in a native valve: case report" ppsx
... Page of Figure Artist’s depiction of intraoperative appearance and surgical repair of aortic valve The left coronary cusp is small and the nodulus of Arantius is absent on that cusp The repair ... echocardiography There are many patients who present for surgical repair due to abnormal valves with small leaflets that have absent or effaced noduli of Arantius, and yet the presentation of intermittent ... Bode C, Geibel A: In vivo analysis of aortic valve dynamics by transesophageal 3-dimensional echocardiography with high temporal resolution Journal of Thoracic and Cardiovascular Surgery 2003,...
- 4
- 308
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose