... organic acid stress Auxotrophic requirements for aromatic amino acids dramatically increase sensitivity to weak organic acid stress, a sensitivity suppressed byaminoacid supplementation Platings of ... to catalyse uptake of aromatic amino acids from the medium Probably this is due to the weak organic acid exerting a strong inhibition of the activity of the Tat2p aminoacid permease, though this ... Viegas, C .A & Correia, I (2000) Expression of the AZR1 gene (ORF YGR224w), encoding a plasma membrane transporter of the major facilitator superfamily, is required for adaptation to acetic acid and...
... METABOLISM OF METAL AMINOACID CHELATES AND INORGANIC METAL SALTS H DeWayne Ashmead INCREASING INTESTINAL DISACCHARIDASE ACTIVITY IN THE SMALL INTESTINE WITH AMINOACID CHELATES Silvano Maletto ... Station Lake Hamanako Branch Shizuoka, Japan XVII Takatsuka, Takeharu Shizuoka Prefectural Fisheries Experimental Station Lake Hamanako Branch Shizuoka, Japan Volpelli, L A University of Bologna Bologna, ... W Hardy and Karl D Shearer THE EFFECTS OF IRON AMINOACID CHELATE IN CULTURE EELS Katsuhiro Suzuki, Yoshito Iwahasi, Takeharu Takatsuka and Takaaki Wakabayashi 413 424 440 SECTION SUMMARY AND...
... environmental factors such as UV radiation and physiological stress such as starvation may affect this supraorganization are also presented MATERIALS AND METHODS Chemicals Reagent-grade phosphoric acid, ... b-phycocyanins, but not of allophycocyanins which also contain bilins [28] Because it is difficult to attribute the specific damage to variations in aromatic amino- acid content, because the amino- acid ... composition and supramooptical decreases observed could be correlated to the lecular organization of phycobilisomes and may increase the damage of aromatic amino acids, this could not explain understanding...
... yeast DAAO variants with substantially increased activity at low O2 and d -amino acid concentrations This could lead to better efficacy in therapeutic applications Results Selection of DAAO variants ... DAAO and ⁄ or d-Ala addition) was taken as 100% of survival Toxicity was quantified as the fraction of surviving cells relative to the untreated cells as control Oxygen reactivity of D -amino acid ... such as those reported in (A) tive half-reaction obtained for Q144R-DAAO are identical to those of wt-DAAO, a detailed kinetic investigation of this mutant DAAO was not carried out As with wt-DAAO...
... nonlinear result will turn back to a linear result Numerical results obtained for a GaAs/GaAsAl CQW show that α depends strongly and nonlinearly on the temperature T of the system As the temperature ... the nonlinear absorption coefficient ofa strong EMW for a GaAs/GaAsAl RQW The parameters of the CQW The parameters used in the numerical calculations [6,13] are ξ = 13.5 eV , ρ = 5.32 gcm −3 , ... system As the temperature increases the nonlinear absorption coefficient increases until it reached the maximum value (peak) and then it decreases At different values of the size Lx and Ly of wire...
... CCTGCAGGATGCCCCTGGAG CCTGCAGGATGAGCCTGGAG GCTGAACCCAGAAGTGCTGTCGCCC ACCCAGAAGTGCTGTCGCCCAACGCCG TGC Ó FEBS 2002 1120 S Bechtel et al (Eur J Biochem 269) Transient transfections and enzymatic assays ... from H Takemori, Department of Physiological Chemistry, Osaka University Medical School Osaka, Japan) The total amounts of protein were quantified using a BCA assay kit, according to the manufacturer’s ... a faster and easier passage of the substrate, possibly causedbya substrate access channel enlargement (Fig 5) Also, the slightly reduced oxidation activity of these constructs suggests a facilitated...
... is associated with an increased prevalence of visual impairment Black Americans have a rate of visual impairment almost twice the rate of white Americans From 65 years there is a steady decrease ... attention FunctionalAssessment Screening Instruments Functional capacity can be assessed partially by validated questionnaires and screening instruments that can be administered by trained office staff ... white Americans and glaucoma is the most frequent cause of blindness among black Americans Simple Visual Testing can be done by asking patients to read a few lines from a newspaper If a patient can...
... Analyzer (Applied Biosystems Japan Ltd, Tokyo, Japan) Biochemical properties of the bacterial species were analyzed using API50 CHB and API20E test kits ´ (bioMerieux Japan, Tokyo, Japan) Heat ... removed by filtration using a bottle top vacuum filtration system (Asahi Techno Glass Co., Chiba, Japan) Ammonium sulfate was further added to the filtrate to increase its concentration to 60% saturation, ... ABI3100 analyzer Functional expression of the insecticidal toxin (SMC) in E coli The SMC gene amplified by PCR using the vector sense (VS) (5¢-GGGAATTCCATATGGAAGTGTCTACAA ATC-3¢) and vector antisense...
... reverse the relative volatility TABLE 111 SMOOTHED VAPOR-LIQUID EQUILIBRIUM BOIL- of acetic acid and water The reversal takes place a t about ARD ING POINT DATA FOR ACETIC ACID- WATER-CALCIUM CHLORIDE ... because of the lack of available data on the boiling points of solutions of calcium chloride in glacial acetic acid CONCLUSIONS The results confirm the observation of Quartaroli (9) that the by ... portion ofa cellulose acetate washed with water containing a certain salt to the viscosity ofa second portion of the same acetate washed with salt-free water or with water containing a salt known...
... independent of the annealing ambient PDA in air causeda negative shift of the C–V curves due to positive charge generation and also caused an enhanced accumulation capacitance, which originated from a ... relaxation of the as-deposited film obeyed a mixed CS and HN relationships After the 900°C PDA, the relaxation behavior of the N -annealed film was dominated by the CS law, whereas the air-annealed ... k-value was maintained and the dielectric relaxation was reduced However, PDA in air causes a significant increase in k-value (32 at kHz) and a significant dielectric relaxation, probably associated...
... 270 Jae-Won Byun et al Briefly, primers FUS (5´-ATACAGGCTGAAATTGCAGG3´) and FDS (5´-CTTGCGAAAACCAGTTTAGG-3´) designed from se18.9 were used to amplify chromosomal o DNA in bacteria The PCR reaction ... scattered in alveolar lumen and also engulfed by alveolar macrophages (arrows) Gram stain Scale bar = 20 μm (C) Liver Bacterial clumps are infiltrated in the sinusoid Gram stain Scale bar = 50 μm (D) ... CAV-2 (USBiological, USA) and CPIV (USBiological, USA) Grossly, large amounts (50∼150 mL) of dark red fluids filled the thorax of all carcasses The lungs failed to collapse and were hemorrhagic,...
... m2) was estimated bya linear weight-surface relationship established on a sample of nine saplings (leaf area measured after digitising leaf with “DeltaT Scan” software, A T Delta-T Device, Cambridge, ... course of predawn leaf water potential (ΨLpredawn) (a, d), stomatal conductance (gs) (b, e) and whole plant transpiration (Esapling) (c, f) measured in 1999 on Castanea sativa saplings grown in a ... S.D.) Figure General plot of stomatal conductance (gs) as a function of predawn leaf water potential (ΨLpredawn) of Castanea sativa saplings inoculated with Phytophthora cinnamomi with different...
... as edema often involves the mucosa of the meso-and hypopharynx in addition Intriguingly, edema-formation spares the mucosa of the nasal cavity and of the paranasal sinuses The exact anatomical ... the term ‘laryngeal edema’ with ‘upper airway edema (UAE)’ seems more appropriate and accurate The diagnosis of UAE 3.1 Clinical manifestations and localization of UAE Recognizing airway involvement ... endotracheal intubation) Dental surgery is a leading cause, potentially associated with fatal UAE [15,22-24] Before the diagnosis of HAE is established, facial edema or UAE associated with a dental...
... STAI-S and the VAS -A After that, the experimental session started, and heart rate, skin conductance and respiration rate were Several within-subject repeated measure analysis of variance (ANOVA) ... averages of anorexia (AN) and bulimia nervosa (BN) groups AN, mean (SD) BN, mean (SD) Page of 10 reflects a 'transitory emotional state or condition of the human organism that is characterized by subjective, ... interpretation: high scores mean more state anxiety and low scores mean less Visual analogue scale for anxiety (VAS -A) The VAS -A [22] is a 100 mm vertical line with end points anchored as no anxiety at...
... coverage, as indicated by the A- statistic, suggested that a contig was duplicated even though our analysis of mate pairs indicated that it was spurious In each case, the mated reads associated ... greater than four standard deviations away, and then estimated the parameters again 'Nonparametric' plots the actual density of mate pair distances after running a cubic smoothing spline The actual ... ED, Archidiacano N, Eichler EE: A preliminary comparative analysis of primate segmental duplications shows elevated substitution rates and a great-ape expansion of intrachromosomal duplications...
... Onishi M, Nosaka T, Misawa K, Mui AL, Gorman D, McMahon M, Miyajima A, Kitamura T: Identification and characterization ofa constitutively active STAT5 mutant that promotes cell proliferation Mol ... detected by incubation with goat antiserum against gp120 (Dunn Labtech, Ansbach, Germany) or a polyclonal antiserum directed against MLV p30 [1], followed by an incubation with a horseradish peroxidase-labeled ... MLV/HIV-1 particles was analyzed by Western blot analysis of particles concentrated from FLY cell supernatants by ultracentrifugation Equal loading was confirmed after stripping the blot and incubating...
... Page of Figure Artist’s depiction of intraoperative appearance and surgical repair of aortic valve The left coronary cusp is small and the nodulus of Arantius is absent on that cusp The repair ... echocardiography There are many patients who present for surgical repair due to abnormal valves with small leaflets that have absent or effaced noduli of Arantius, and yet the presentation of intermittent ... Bode C, Geibel A: In vivo analysis of aortic valve dynamics by transesophageal 3-dimensional echocardiography with high temporal resolution Journal of Thoracic and Cardiovascular Surgery 2003,...