0

frosch and j roth 2008 new insights in systemic juvenile idiopathic arthritis—from pathophysiology to treatment rheumatology 47 2 pp 121 125

Báo cáo y học:

Báo cáo y học: " Immature cell populations and an erythropoiesis gene-expression signature in systemic juvenile idiopathic arthritis: implications for pathogenesis" ppt

Báo cáo khoa học

... Cancer 20 08, 50: 122 7- 123 5 12 Henter JI, Horne A, Arico M, Egeler RM, Filipovich AH, Imashuku S, Ladisch S, McClain K, Webb D, Winiarski J, Janka G: HLH -20 04: diagnostic 21 22 23 24 25 26 27 28 29 ... competing interests 20 Received: 13 November 20 09 Revised: May 20 10 Accepted: 24 June 20 10 Published: 24 June 20 10 References Woo P: Systemic juvenile idiopathic arthritis: diagnosis, management, and ... CD163 and soluble interleukin -2 receptor alpha-chain in macrophage activation syndrome and untreated new- onset systemic juvenile idiopathic arthritis Arthritis Rheum 20 07, 56:965-971 Villanueva J, ...
  • 13
  • 416
  • 0
Báo cáo y học:

Báo cáo y học: "Bench-to-bedside review: Mobilizing patients in the intensive care unit – from pathophysiology to clinical trials" pot

Báo cáo khoa học

... protein synthesis during prolonged inactivity and stress J Clin Endocrinol Metab 20 06, 91:4836-4841 22 Tidball JG, Spencer MJ: Calpains and muscular dystrophies Int J Biochem Cell Biol 20 00, 32: 1-5 ... with acute lung injury J Crit Care 20 07, 22 :27 5 -28 4 Pingleton SK: Nutrition in chronic critical illness Clin Chest Med 20 01, 22 :149-163 De Jonghe B, Bastuji-Garin S, Sharshar T, Outin H, Brochard ... shift toward increased production of anti-inflammatory cytokines [9] Typically, IL-6 (which has anti-inflammatory properties) is the first cytokine to rise during exercise, increasing up to 100-fold...
  • 8
  • 289
  • 0
GASTRITIS AND GASTRIC CANCER – NEW INSIGHTS IN GASTROPROTECTION, DIAGNOSIS AND TREATMENTS docx

GASTRITIS AND GASTRIC CANCER – NEW INSIGHTS IN GASTROPROTECTION, DIAGNOSIS AND TREATMENTS docx

Sức khỏe giới tính

... lesions in rats Eur J Pharmacol Vol.6 52, No.1-3, pp. 121 - 125 , ISSN 1879-07 12 Kato, S.; Tanaka, A.; Kunikata, T.; Umeda, M & Takeuchi, K (20 00) Protective effect of lafutidine against indomethacin-induced ... pp .22 9 -23 5, ISSN 0 021 -5198 Ota, H & Katsuyama, T (19 92) Alternating laminated array of two types of mucin in the human gastric surface mucous layer Histochem J Vol .24 , No .2, pp. 86- 92, ISSN 001 822 14 ... well as in medical treatment involving anticholinergic agents, histamine H2 receptor inhibitors, proton pump inhibitors during the last century From the initial observation of capsaicin desensitation...
  • 308
  • 428
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "New insights in the recognition of the European ash species Fraxinus excelsior L. and Fraxinus angustifolia Vahl as useful tools for forest management" pdf

Báo cáo khoa học

... GGAAGTCGCCCTCTTTTGC ( C) (%) 1 -21 21 59.8 52. 4 27 3 -29 2 20 57.3 50.0 5 -22 18 58 .2 61.1 738-757 20 57.3 50.0 2- 22 21 57.9 47. 6 1531-1549 19 58.8 57.9 F19LgF TTGATATAGGAATGCCAGAGC 3 -23 21 57.0 42. 9 F19LgR CAGATACTCGCGTATGATGGTC ... 53◦ 20 ’ 54◦ 14’ 52 36’ 51◦ 47 54◦ 01’ 49◦ 40’ 49◦ 01’ 49◦ 21 ’ 45◦ 08’ 48◦ 31’ 48◦ 42 48◦ 29 ’ 3◦ 47 2 57’ 10◦ 38’ 12 28 ’ 11◦ 13’ 7◦ 39’ 24 ◦ 25 ’ 24 ◦ 00’ 14◦ 20 ’ 6◦ 45’ 7◦ 28 ’ 8◦ 53’ 1◦ 20 ’ ... (0.09) 0.73 (0.10) 0 10 14 12 14 14 60 (2) 0.59 (0.08) 12 (10) (8) 0.70 (0.11) 0.65 (0.11) Na Country Code Lat Long 17 15 20 14 20 20 20 20 18 16 20 17 15 12 20 20 19 21 20 24 376 Germany Belgium...
  • 6
  • 521
  • 0
The genius in all of us  new insights in   david shenk

The genius in all of us new insights in david shenk

Kỹ năng tư duy

... remaining di erences in intelligence are increasingly determined by di erences in genes … Putting it all together, success and failure in the American economy, and all that goes with it, are increasingly ... passion to aim consistently just beyond one’s capability so that daily disappointment and failure is actually desired, and a never-ending resolve to dust oneself o and try again and again and again ... marks in the main text to the corresponding sources and notes in the Evidence section and then link directly to many of my original online sources With about half of the book’s content residing in...
  • 239
  • 919
  • 0
Báo cáo y học:

Báo cáo y học: " New insights in understanding the pathogenesis of spondyloarthropathies" pdf

Báo cáo khoa học

... no competing interests Published: 18 January 20 10 References Sharma SM, Choi D, Planck SR, Harrington CA, Austin CR, Lewis JA, Diebel TN, Martin TM, Smith JR, Rosenbaum JT: Insights in to the pathogenesis ... print: doi:10.1136/ard .20 09.111690] Couzin J: Human genetics In Asians and whites, gene expression varies by race Science 20 07, 315:173-174 Davis JC, Jr, Mease PJ: Insights into the pathology and ... expression profiling in human autoimmunity Immunol Rev 20 06, 21 0: 120 -137 doi:10.1186/ar2895 Cite this article as: van der Horst-Bruinsma IE, Crusius JBA: New insights in understanding the pathogenesis...
  • 2
  • 226
  • 0
Will vietnamese language be maintained in taiwan language use and attitude of vietnamese new immigrants in taiwan (Tóm tắt  trích đoạn)

Will vietnamese language be maintained in taiwan language use and attitude of vietnamese new immigrants in taiwan (Tóm tắt trích đoạn)

Cao đẳng - Đại học

... Table 25 Attitudes towards Mandarin Questions mean s.d in order 1 think Mandarin is helpful in life 4. 92 0 .27 2 Mandarin is helpful to children’s education 4.97 0.18 Mandarin is helpful to find job ... convenient store 11 17 .2 1.6 14.1 13 20 .3 30 46.9 temple or church 25 39.1 6 .2 12. 5 14.1 18 28 .1 hospital 16 25 .0 4.7 12. 5 11 17 .2 26 40.6 public clinic 17 26 .6 3.1 10.9 11 17 .2 27 42. 2 NIA* 13 20 .3 ... 0 .29 Mandarin is helpful to raise status in family 4. 12 1.10 It’s proud to speak fluent Mandarin 3. 72 1.37 My children must learn Mandarin since childhood 4.89 0. 32 am afraid not being able to...
  • 27
  • 286
  • 0
Tài liệu Báo cáo khoa học: Moult cycle-related changes in biological activity of moult-inhibiting hormone (MIH) and crustacean hyperglycaemic hormone (CHH) in the crab, Carcinus maenas From target to transcript ppt

Tài liệu Báo cáo khoa học: Moult cycle-related changes in biological activity of moult-inhibiting hormone (MIH) and crustacean hyperglycaemic hormone (CHH) in the crab, Carcinus maenas From target to transcript ppt

Báo cáo khoa học

... J S Chung and S G Webster (Eur J Biochem 27 0) synthesized products from neurosecretory terminals, for example in locusts [22 ,23 ], molluscs [24 ], mammals [25 ], crabs [26 ] and shrimps [27 ] Thus, ... mm) and immediately frozen in liquid N2 and stored at )80 °C Membrane rich fractions were prepared as described previously [14] Receptor binding assays for MIH and CHH using 125 I-labelled ligands ... that during premoult, increases in cGMP levels following a 30-min incubation in peptide were dramatically blunted during premoult, and that competence to respond to peptide was restored in late...
  • 9
  • 587
  • 0
plato and aristotle in agreement platonists on aristotle from antiochus to porphyry jun 2006

plato and aristotle in agreement platonists on aristotle from antiochus to porphyry jun 2006

Vật lý

... Simplicius, In Phys 420 13 421 and Vitelli (19 92) , fr 2, on which more in Ch 4, s 133 Cf e.g In Top 540 17541 6; in Simplicius, In Phys 355 1318 134 Simplicius, In Phys 1 121 28 1 122 3; In de caelo 27 6 1 429 ... Physics 20 2b3 420 3a16, 20 6b1633, 20 9b1117; NE 1172b2831; De caelo 28 0a2830, 300b1619; De gen et corr 325 b2433, 330b1517, 332a2730; Pr An 67a 227 ; Post An 71a29b8 48 NE 1144b1730; EE 124 6b 327 ; esp ... caelo 27 9b 428 3b 22; NE 1096b58; De gen et cor 315a1433; 329 a1314, 335b1011; Top 152a2530; De part anim 642b 520 See Cherniss (1944) and Jaeger (1948: 17193) 54 See Ch 1, pp 524 , ch 7, pp 24 9 52 55...
  • 426
  • 183
  • 0
báo cáo sinh học:

báo cáo sinh học:" The course of specialization in public health in Rio de Janeiro, Brazil, from 1926 to 2006: lessons and challenges Monireh Obbadi" ppt

Điện - Điện tử

... 40 - 1949 321 20 8 188 1950 - 1959 23 0 168 94 1960 - 1969 609 349 28 9 1970 - 1979 1 022 487 433 1980 - 1989 1667 330 309 1990 - 1999 877 25 0 22 3 20 00 - 20 06 1 428 22 0 178 Totals 6154 20 12 1873 Source: ... pertinent comments and valuable inputs to this article Competing interests The author declares that she has no competing interests Received: July 20 09 Accepted: March 20 10 Published: March 20 10 ... Cruz Institute wished to collaborate more closely with the Faculty of Medicine He wanted to bring hygiene and clinical problems related to rural diseases into medical practice, thereby creating...
  • 5
  • 435
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Risk factors for low birth weight in Botucatu city, SP state, Brazil: a study conducted in the Public Health System from 2004 to 2008" pptx

Hóa học - Dầu khí

... weight in the period of the study was 10 .2% considering all live newborns in the period in the denominator (84 42) [17 ,22 ] Data on 1 720 newborns included in the study were obtained in LBC and information ... ¹ 22 or less 1–3 23 27 or more 28 –31 or more 32 36 or more 37 or more or more ¹ Adequacy from PHPN and Kessner Index [20 ,25 ,26 ] Ethics Following the ethical principles established in the Helsinki ... of Live Births (SINASC) in the years of 20 04, 20 05, 20 06, 20 07 and 20 08, the number of live births were 1667, 17 02, 1670, 1675 and 1 728 respectively, amounting 84 42 live newborns Data of DATASUS...
  • 18
  • 422
  • 0
Báo cáo y học:

Báo cáo y học: "Lack of association between glucocorticoid use and presence of the metabolic syndrome in patients with rheumatoid arthritis: a cross-sectional study" ppsx

Báo cáo khoa học

... LE and NE Systolic blood pressure increased as GC exposure increased (NE 140 ( 126 .25 to 150) mm Hg versus LE 1 42 ( 125 .75 to 159) mm Hg versus ME 145 (135 to 160) mm Hg, P = 0. 022 ) Interestingly, ... antibody treatment improves glucocorticoid induced insulin-like growth factor 1(IGF1) resistence without influencing myoglobin and IGF1 binding proteins and Ann Rhuem Dis 20 06, 65:301-305 Fraser R, Ingram ... 20 04, 22 :S77-S 82 61 Panoulas VF, Metsios GS, Pace AC, John HJ, Treharne GJ, Banks MJ, Kitas GD: Hypertension in rheumatoid arthritis Rheumatology (Oxford) 20 08, 47: 128 6- 129 8 62 Hafstrom I, Rohani...
  • 8
  • 561
  • 0
Báo cáo y học:

Báo cáo y học: " An association between the acute phase response and patterns of antigen induced T cell proliferation in juvenile idiopathic arthritis" ppt

Báo cáo khoa học

... associated with reac- R283 Arthritis Research & Therapy 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 R284 Vol No Black et al tive arthritis in pauciarticular juvenile chronic arthritis ... radioiodinated human C-reactive protein in health and disease J Clin Invest 1993, 90:1351-1357 Badolato R, Ming Wang J, Murphy WJ, Lloyd AR, Michiel DF, Bausserman LL, Kelvin DJ, Openheim JJ: Serum ... which may assist in T cell retention within the mucosal site [28 ,29 ] The results of our studies support a similar process of ‘integrin switching’ in the joint Our findings are in agreement with...
  • 8
  • 359
  • 0
Báo cáo y học:

Báo cáo y học: "Increased interleukin-17 production via a phosphoinositide 3-kinase/Akt and nuclear factor κB-dependent pathway in patients with rheumatoid arthritis" ppt

Báo cáo khoa học

... breakdown in vitro and in vivo Cytokine 20 01, 16:10 -21 LeGrand A, Fermor B, Fink C, Pisetsky DS, Weinberg JB, Vail TP, Guilak F: Interleukin-1, tumor necrosis factor alpha, and interleukin-17 synergistically ... signaling pathway involving phosphoinositide 3-kinase (PI3K)/Akt and NF-κB might be involved in the overproduction of the key inflammatory cytokine IL-17 in RA These results might provide new insights ... produce proinflammatory and hematopoietic cytokines J Exp Med 1996, 183 :25 93 -26 03 Miossec P: Interleukin-17 in rheumatoid arthritis: if T cells were to contribute to inflammation and destruction...
  • 10
  • 346
  • 0
Báo cáo y học:

Báo cáo y học: "Phenotypic and functional characterisation of CD4+ memory T cells homing to the joints in juvenile idiopathic arthritis" pps

Báo cáo khoa học

... vessels in normal and arthritic human synovial tissues Ann Rheum Dis 20 03, 62: 122 7- 122 9 Haringman JJ, Ludikhuize J, Tak PP: Chemokines in joint disease: the key to inflammation? Ann Rheum Dis 20 04, ... activity and treatment at the moment of sampling Expression of CCL21 in SF and synovial tissue To gain further insight into the relevance of the interactions between CCR7 and its ligand CCL21 in vivo, ... structures In contrast, CCR5+ cells were detected mainly in the lining layer and in the sublining zone of the superficial subintima and, to a smaller extent, in the perivascular infiltrates of sublining...
  • 12
  • 359
  • 0
Báo cáo y học:

Báo cáo y học: "Expression of the inflammatory chemokines CCL5, CCL3 and CXCL10 in juvenile idiopathic arthritis, and demonstration of CCL5 production by an atypical subset of CD8+ T cells" pps

Báo cáo khoa học

... Therapy 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 Vol No Pharoah et al CXCR3 and CCR5 mark subsets of T cells associated with certain inflammatory reactions J Clin Invest 1998, 101:746-754 ... cells homing to the joints in juvenile idiopathic arthritis Arthritis Res Ther 20 05, 7:R256 -26 7 Tak PP, Taylor PC, Breedveld FC, Smeets TJ, Daha MR, Kluin PM, Meinders AE, Maini RN: Decrease in cellularity ... TNF-alpha inhibitors Rheumatology (Oxford) 20 05, 44:1 72- 175 Haringman JJ, Kraan MC, Smeets TJ, Zwinderman KH, Tak PP: Chemokine blockade and chronic inflammatory disease: proof of concept in patients...
  • 11
  • 508
  • 0
Báo cáo y học:

Báo cáo y học: "Lack of association between mannose-binding lectin gene polymorphisms and juvenile idiopathic arthritis in a Han population from the Hubei province of China" docx

Báo cáo khoa học

... infections and mannose-binding lectin insufficiency during early childhood JAMA 20 01, 28 5:1316-1 321 Garred P, Madsen HO, Halberg P, Petersen J, Kronborg G, Svejgaard A, Andersen V, Jacobsen S: ... S: Mannose-binding lectin polymorphisms and susceptibility to infection in systemic lupus erythematosus Arthritis Rheum 1999, 42: 2145 -21 52 Ip WK, Lau YL, Chan SY, Mok CC, Chan D, Tong KK, Lau ... in UK patients Rheumatology 20 02, 41:1183-1189 Aittoniemi J, Baer M, Soppi E, Vesikari T, Miettinen A: Mannan binding lectin deficiency and concomitant immunodefects Arch Dis Child 1998, 78 :24 5 -24 8...
  • 4
  • 318
  • 0
Báo cáo y học:

Báo cáo y học: "Lack of association between glucocorticoid use and presence of the metabolic syndrome in patients with rheumatoid arthritis: a cross-sectional study" pptx

Báo cáo khoa học

... LE and NE Systolic blood pressure increased as GC exposure increased (NE 140 ( 126 .25 to 150) mm Hg versus LE 1 42 ( 125 .75 to 159) mm Hg versus ME 145 (135 to 160) mm Hg, P = 0. 022 ) Interestingly, ... antibody treatment improves glucocorticoid induced insulin-like growth factor 1(IGF1) resistence without influencing myoglobin and IGF1 binding proteins and Ann Rhuem Dis 20 06, 65:301-305 Fraser R, Ingram ... 20 04, 22 :S77-S 82 61 Panoulas VF, Metsios GS, Pace AC, John HJ, Treharne GJ, Banks MJ, Kitas GD: Hypertension in rheumatoid arthritis Rheumatology (Oxford) 20 08, 47: 128 6- 129 8 62 Hafstrom I, Rohani...
  • 8
  • 531
  • 0
báo cáo khoa học:

báo cáo khoa học:" Multimorbidity and health-related quality of life in the older population: results from the German KORA-Age study" ppsx

Báo cáo khoa học

... 1.41** 2. 07*** 1.18 2. 02* ** Cancer 1.35** 1.36** 1.30 1. 32 1.45** 1 .47* ** 1.07 1.08 1 .22 * 1 .22 * Bronchitis 2. 33*** 2. 34*** 2. 44*** 2 .47* ** 2. 21*** 2. 24*** 2. 40*** 2. 41*** 1. 72* ** 1.73*** Hypertension ... Quality of Life Outcomes 20 11, 9:53 http://www.hqlo.com/content/9/1/53 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 Hodek JM, Ruhe A, Greiner W: [Multimorbidity and health-related quality ... 20 10, 8:18 42 Flicker L, McCaul KA, Hankey GJ, Jamrozik K, Brown WJ, Byles JE, Almeida OP: Body mass index and survival in men and women aged 70 to 75 J Am Geriatr Soc 20 10, 58 (2) :23 4 -24 1 43 Michelson...
  • 10
  • 281
  • 0
báo cáo khoa học:

báo cáo khoa học:"Spinsterhood and its impact on disease features in women with rheumatoid arthritis" pptx

Báo cáo khoa học

... 11.45 ± 3 .27 12. 07 ± 3.7 12. 2 ± 3.65 0. 021 Swollen joints (0 -28 ) 7.97 ± 5 .25 5.89 ± 2. 42 5.3 ± 2. 27 5 .47 ± 3.1 0.004 ESR (mm) 47. 30 ± 17.44 47. 71 ± 18.37 48.79 ± 16.31 45.85 ± 19.17 0.0 62 CRP (mg/l) ... functioning 39.88 ± 25 .86 55.31 ± 23 .83 Role limitation 36.30 ± 27 .53 63.51 ± 22 .05 57.55 ± 27 .58 59.49 ± 28 .47 < 0.001 66.11 ± 23 .39 65. 72 ± 29 . 02 Role emotional 38.46 ± 27 .65 72. 85 ± 26 .67 73. 32 ... ± 6.48 47. 27 ± 3 .22 55.76 ± 5.66 0.003 Age at onset (years) 29 .81 ± 11.65 36. 52 ± 11.76 34.6 ± 12. 23 34. 72 ± 12. 34 0.009 VAS pain intensity (0-100) Morning stiffness(min) 67.14 ± 18.11 72. 05 ±...
  • 4
  • 306
  • 0

Xem thêm