framework the thesis writer believes that this paper holds a crucial role in facilitating studying english in general and text linguistics in particular
Báo cáo khoa học: A novel gene, fad49, plays a crucial role in the immediate early stage of adipocyte differentiation via involvement in mitotic clonal expansion docx
... reported that the PX domain of p47phox binds intramolecularly to the SH3 domain in the same protein, and that this intramolecular interaction suppresses the lipid-binding activity of the PX domain in ... found in the FAD49 PX domain, as in many PX domains, suggesting that the PX domain could bind to an SH3 domain of FAD49 To test whether the PX domain could interact with an SH3 domain in FAD49, ... (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions The total RNA was converted to single-stranded cDNA using a random primer and ReverTra Ace (Toyobo, Osaka, Japan) The...
- 13
- 385
- 0
Báo cáo khoa học: Kinetic studies and molecular modelling attribute a crucial role in the specificity and stereoselectivity of penicillin acylase to the pair ArgA145-ArgB263 pdf
... substrates The data for the PA catalysed hydrolysis of PhAc-Asp and PhAc-Glu [13] and our data for PhAc-pAB, PhAc-mAB and PhAcoAB (Table 2) imply that the COOH group has to be positioned as in NIPAB ... structural data for the PA–substrate interactions in the transition state are missing and only a GRID computational modelling approach to the tetrahedral intermediate in PA presents some indications ... Wegman, M .A. , Cao, L & Janssen, M.H .A (2001) Biocatalysis and biocatalyst in the synthesis of b-lactam antibiotics In: Synthesis of b-Lactam Antibiotics Chemistry, Biocatalysis and Process Integration...
- 8
- 438
- 0
Báo cáo khoa học: Nuclear aggregates of polyamines are supramolecular structures that play a crucial role in genomic DNA protection and conformation potx
... play a greater role in the A Z transition than they in the B–Z transition, because the difference in the linear charges density is greater between the A and the Z forms than between the B and the ... the charge attraction between DNA phosphates and the amino groups of polyamines As the amino groups of polyamines are already engaged in ionic bonds with the phosphates of NAPs, secondary amino ... DNA preincubated with l-NAP showed a diffuse migration pattern, whereas the DNA interacting with s-NAP and m-NAP migrated in a compact form similar to that of naked DNA (lane a) , but significantly...
- 11
- 380
- 0
báo cáo khoa học: " Determinants of the intention of elementary school nurses to adopt a redefined role in health promotion at school" docx
... Group on Behaviour and Health, Faculty of Nursing, Laval University, Québec, Canada 2Canada Research Chair on Behaviour and Health, Laval University, Québec, Canada 3Faculty of Nursing, Laval University, ... behavioural determinants of the adoption by nurses of health-promotion roles Indeed, the literature is mainly anecdotal, and the rare quantitative studies are based on small sample sizes and not always ... feelings of worth and produce evidence-based knowledge that can promote their role as decision makers [56] Findings also indicate that a nursing shortage and leadership require that action be taken...
- 10
- 458
- 0
CLEANER PRODUCTION AUDIT IN THE PULP AND PAPER INDUSTRY: A CASE STUDY IN VIETNAM doc
... for the paper machines including washing wire and washing blanket was measured Then the water consumption for paper machine was calculated from flow rate, paper machine velocity and product amount ... washing stage ligninand remaining chemicals are removed The depithed pulp is transported to the storage tank then pumped to a beater Waste paper and water are added into beater Here pulp and waste ... my beloved parents iii ABSTRACT Van Diem Paper Mill is a small integrated paper mill that uses bagasse and waste paper as raw material The mill manufactures carton board, cover paper, pupil...
- 98
- 761
- 0
Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx
... Plasmid pC4Meth-100TorA/P2 was constructed by PCR, using pTorA/P2 [17] as a template and the primers RRTorA-SacI-fw (5¢-GCGCGGAGCTCAAGAAGGA AGAAAAATAATGAAC-3¢, SacI site underlined) and TorA/Lep2-BamHI-rv ... CCTTCCA-3¢, BamHI site underlined) and SufIHAXbaI+ClaI-rv (5¢-ACTGATCGATCTAGATTACGCAT AGTCAGGAACATCGTATGGGTAGCCGCCTGGCG GTACCGGATTGACCAAC-3¢, ClaI site underlined, XbaI site in italics, HA-epitope ... (Uppsala, Sweden) All other chemicals were supplied by Sigma-Aldrich (Steinheim, Germany) Antisera against L23 and L29, TF, SufI, and Table Bacterial strains and plasmids used in this study Strain/plasmid...
- 9
- 393
- 0
The Carbon and Global Warming Potential Impacts of Organic Farming: Does It Have a Significant Role in an Energy Constrained World? pptx
... for E and GHG gains (and again data for the Canadian food system is lacking) and a significant body of literature has examined relative E and GHG efficiency of various freight modes Ultimately, ... Dairying in Maritime Canada; M.Sc Thesis; NSAC and Dalhousie University: Halifax, NS, Canada, 2001 57 Main, M.H.; Lynch, D.; Martin, R.C.; Fredeen, A Sustainability profiles of Canadian dairy farms ... oilseed and pulse grains (DAG); and (iii) a diversified rotation using annual grains and perennial forages (DAP) All crop rotations were years in length Total energy input was highest for the HI and...
- 41
- 524
- 1
Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt
... and one for TNF -a The level of U 1A mRNA was similar in all samples as shown in Fig 4A This indicated equal extraction efficiency and that SK&F 98625 was not a general transcription inhibitor There ... (Kirkegaard and Perry, Gaithersburgh, MD, USA) per well The plate was incubated in the dark for 20 and the reaction stopped by the addition of 50 lL of 0.5 M sulfuric acid The plate was read on a Labsystems ... confirms that IFN-c can increase the activity of an enzyme, LPCAT, that participates in the rapid turnover of PtdCho Lysophospholipid acyltransferases maintain membrane lipid composition and the asymmetrical...
- 7
- 322
- 0
Báo cáo Y học: The a1b1 contact of human hemoglobin plays a key role in stabilizing the bound dioxygen Further evidence from the iron valency hybrids potx
... a1 b1 and a2 b2 interfaces, on the other hand, negligible changes are found insofar as the crystal structure was examined Consequently, these are called simply the packing contacts, and their role ... used this time the valency hybrid tetramers As a result, the b chain was found to acquire a noticeable resistance against the acidic autoxidation in a manner of contacting with the a chain, no matter ... isolated a chain In contrast to this, the heme pocket of the b chain still obstructs easy access of a water molecule as well as a proton, so that the b chains can keep a constant resistance against...
- 10
- 648
- 0
the impact of human capital on economic growth. a case study in post-soviet ukraine, 1989 - 2009
... domestic savings Higher saving rates (S) finance capital accumulation and growth However, the equation makes the important point that the immediate impact of saving on growth is minor Assume that the ... capita quantities k, y, and c not grow in the steady state The constancy of the per capita magnitudes means that the levels of variables—K, Y, and C—grow in the steady state at the rate of population ... institutions in static and dynamic sense: In a static sense, institutions define the costs of transacting and the ability of organizations to capture the gains from specialization and division of labor In...
- 228
- 843
- 1
Báo cáo khoa học: "SemiPro-inflammatory cytokines play a key role in the development of radiotherapy-induced gastrointestinal mucositis" pptx
... 5’-GTGCATCATCGCTGTTCATACA TNF Forward: 5’-GTGATCGGTCCCAACAAG-3’ Results 71 X66539 Reverse: 5’-AGGGTCTGGGCCATGGAA-3’ b actin Forward: 5’-AGGCCAACCGTGAAAAGATG-3’ 101 NM_031144 Reverse: 5’-ACCAGAGGCATACAGGGACAA-3’ ... radiotherapy Staining was variable between the basal and apical regions of the crypts and did not significantly change of the course of radiotherapy (Data not shown) IL-6 IL-6 staining was weak-moderate ... Briefly there was no histopathological change at any time point in rats that did not receive radiotherapy However, rats that received radiotherapy had an increase in apoptosis in the jejunum and...
- 8
- 335
- 0
Báo cáo y học: "Accelerated cellular senescence in degenerate intervertebral discs: a possible role in the pathogenesis of intervertebral disc degeneration" ppt
... TAMRA 3' 5' GAC AAA TCA TCT TCA TCA CCA CCA C 3' 99.77% ADAMTS 5' GGA CCT ACC ACG AAA GCA GAT C 3' 5' FAM – CCC AGG ACA GAC CTA CGA TGC CAC C – TAMRA 3' 5' GCC GGG ACA CAC GGA GTA 3' 99.74% ADAMTS ... the aging and degenerating intervertebral disc: immunolocalization of senescence-associated beta-galactosidase in human and sand rat discs Spine 2007, 32:321-327 Martin JA, Buckwalter JA: Aging, ... tissue (incorporating AF and NP in continuity) was fixed in 10% neutral buffered formalin and processed to paraffin wax Sections were taken for haematoxylin and eosin staining to score the degree...
- 12
- 617
- 0
báo cáo khoa học: " The transcription factor PHR1 plays a key role in the regulation of sulfate shoot-to-root flux upon phosphate starvation in Arabidopsis" potx
... of coordination and crosstalk must exist between pathways involved in Pi and sulfate transport and homeostasis in plants, important players acting in this coordination remain to be clearly identified ... 10:78 Tomatsu H, Takano J, Takahashi H, Watanabe-Takahashi A, Shibagaki N, Fujiwara T: An Arabidopsis thaliana high-affinity molybdate transporter required for efficient uptake of molybdate from ... M, Hawkesford MJ, Saito K: The roles of three functional sulphate transporters involved in uptake and translocation of sulphate in Arabidopsis thaliana Plant J 2000, 23:171-182 Kataoka T, Hayashi...
- 10
- 427
- 0
Báo cáo y học: "A crucial role for tumor necrosis factor receptor 1 in synovial lining cells and the reticuloendothelial system in mediating experimental arthritis" pps
... statistical and data analysis, interpretation of data, and drafting of the manuscript WBvdB conceived of the study and helped draft the manuscript All authors read and approved the final manuscript ... spleen Local treatment inhibited the proinflammatory cytokine cascade in the joint Gene therapeutic targeting of TNFR1 may be a promising and safer approach for TNFα blockade in RA patients Page 10 ... statistical and data analysis, interpretation of data, and drafting of the manuscript SV, BTvdB, and MBB helped to acquire data JG, SA-R, and FAvdL contributed to the study design, statistical...
- 11
- 319
- 0
Báo cáo y học: "The membrane-spanning domain of gp41 plays a critical role in intracellular trafficking of the HIV envelope protein" pptx
... GGCTTGGTAGGTTTAGCTAGAATAGTTTTTGCT/AGCAAAAACTATTCTAGCTAAAC CTACCAAGCC,695+ 2A, GAGGCTTGGTAGGTGCTG CCTTAAGAATAGTTTTTGC/GCAAAAACTATTCTTAAGGCAGCACCTACCAAGCCTC,695+ 3A, GTAG GAGGCTTGGTAGGTGCGGCCGCATTAAGAATAGTTTTTGCTGTACGTACAGCAAAAACTATTCTTAATGCGGCCGCACCTACCAAGCCTCCTAC, ... GCTTGGTAGGTTTAGCTGCCAGAATAGTTTTTGCTG/CAGCAAAAACTATTCTGGCAG CTAAACCTACCAAGC,695/696+ 2A, GAGGCTTGGTAGGTGCTGCCTTAGCTGCCAGAATAGTTTTT GCTG/CAGCAAAAACTATTCTGGCAGCTAAGGCAG CACCTACCAAGCCTC The NheI-BamHI fragment ... GAGGCTTGGTAGGTGCGGCCGCATTAAGAATAGTTTTTGCTGTACGTACAGCAAAAACTATTCTTAATGCGGCCGCACCTACCAAGCCTCCTAC, 695+ 4A, GGAGGCTTGGTAGGTGCGGCCGCAGCCTTAAGAATAGTTT TTGCTGTAC/GTACAGCAAAAACTATTCTTAAGGCTGCGGCCGCACCTACCAAGCCT CC,696+ 2A, GCTTGGTAGGTTTAGCTGCCAGAATAGTTTTTGCTG/CAGCAAAAACTATTCTGGCAG...
- 12
- 337
- 0
Báo cáo y học: "Impact of the introduction of new vaccines and vaccine wastage rate on the cost-effectiveness of routine EPI: lessons from a descriptive study in a Cameroonian health district" potx
... transportation of vaccines, reporting (immunization and disease surveillance), coordination meetings, supervision, and cold chain temperature monitoring and maintenance It was estimated that vaccination sessions ... Ngong with a large area and a sparse and very mobile population disseminated in many small villages, introduces both a high risk of vaccine wastage and a high risk of dropout Furthermore, the top-down ... strategy The wastage rate was generally lower in the fixed strategy except for OPV (table 4) Whereas for traditional antigens, such as BCG and OPV, the district wastage rate was within the accepted...
- 8
- 302
- 0
Báo cáo y học: "Translational control plays a prominent role in the hepatocytic differentiation of HepaRG liver progenitor cells" docx
... demonstrate an increased translation of these transcripts and validate the array data indicating no change or a slight decrease in LTBP1, SYNE-1 and MMP3 transcript levels in the total RNA compartment and ... pathway, playing a key role in antiviral defense, inflammation and injury [32] and the up-regulation of complement C3 with a role in innate immunity as well as in acute phase response [33] This ... first-strand cDNA, the double-strand cDNA, and cRNA were synthesized, and cRNA was fragmented using Affymetrix kits and guidelines [62] All cRNA final products were tested in terms of amount and integrity...
- 14
- 384
- 0
Helping grade 8 students at ha vinh secondary school remember the way to change an active sentence into a passive sentence in present simple tense and past simple tense
... I INTRODUCTION REASON SELECTED THEMES: In recent years, the teaching and learning of foreign languages in general, in particular in English secondary schools are now due attention and extensive ... periods in English progam for several years THE GOAL OF RESEARCH: Changing an active sentence into passive sentence ia a focal and difficult knowledge part in English program as well as in secondary ... so they are passive and lose confidence in the lesson In the process of teaching, I also noticed the embarrassment of some weak students This leads to the fact that they are afraid to study English...
- 17
- 285
- 0
Innovation plays a crucial role for the success of the business
... it e c o m The innovation of starbucks a • Technology Social media : “Social media is a natural extension of our brand because we want to things that are unexpected and to speak to all sorts of ... coffee chain in Viet Nam closed + Menu is not changed, not refresh and new + Not paying appropriate attention to the local’s taste and demand +No style of decoration and design of space SUMMARY Technology ... Innovation plays a crucial role for the success of the business The innovation of Starbucks Innovation helps Starbucks retain its success CONTENT Bad result from no innovation Summary References...
- 17
- 392
- 1
DSpace at VNU: On the robust stability of implicit linear systems containing a small parameter in the leading term
... in linear algebra and classical analysis We will show that the uniform convergence of associated artificial transfer functions on the imaginary axis as the parameter tends to zero plays an important ... http://imamci.oxfordjournals.org/ at University of Birmingham on June 4, 2015 E XAMPLE In general, engineering applications may contain several small parameters and the original equations may be DAEs ... parameter-perturbation direction in the leading term In the main part of this paper, we suppose the following assumption A SSUMPTION A1 Pencil {E, A} is (asymptotically) stable and index{E, A} = The asymptotic...
- 18
- 74
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25