0

fracture in superior tip of the odontoid this type of fracture is potentially unstable it is a relatively rare fracture

Tài liệu Báo cáo Y học: The Fc receptor c-chain is necessary and sufficient to initiate signalling through glycoprotein VI in transfected cells by the snake C-type lectin, convulxin ppt

Tài liệu Báo cáo Y học: The Fc receptor c-chain is necessary and sufficient to initiate signalling through glycoprotein VI in transfected cells by the snake C-type lectin, convulxin ppt

Báo cáo khoa học

... of this binding depends on oppositely charged amino-acid residues within the transmembrane domain of each subunit Point mutations of these amino acids have revealed the importance of the arginine ... crucial for the generation of this signal, as cross-linking of GPVI in the absence of FcR c-chain was unable to promote an increase in phosphorylation of Syk A transmembrane arginine residue and the ... confirming a requirement for the cytoplasmic tail in the association with FcR c-chain The lack of association between the FcR c-chain and a mutant GPVI lacking its cytoplasmic tail explains the failure...
  • 10
  • 506
  • 0
Báo cáo khoa học: Protein expressed by the ho2 gene of the cyanobacterium Synechocystis sp. PCC 6803 is a true heme oxygenase pot

Báo cáo khoa học: Protein expressed by the ho2 gene of the cyanobacterium Synechocystis sp. PCC 6803 is a true heme oxygenase pot

Báo cáo khoa học

... hemin as monitored by the increase in absorbance at 412 nm ()) The increase in absorbance because of the addition of hemin in the absence of Syn HO-2 is indicated (*) Absorption spectra of the complexes ... chromatography on Sephadex G-75, DE-52, and hydroxyapatite The final preparation after chromatography on a hydroxyapatite column was clear and colorless and gave a single band of 29 kDa with about ... difference in the plasmid used might be the cause of the discrepancy In spite that an RNA blot analysis of cyanobacteria grown in light suggested that ho2 is silent [27], the Syn HO-2 obtained in this...
  • 11
  • 347
  • 0
Báo cáo khoa học: Inactivation of phosphorylase is a major component of the mechanism by which insulin stimulates hepatic glycogen synthesis doc

Báo cáo khoa học: Inactivation of phosphorylase is a major component of the mechanism by which insulin stimulates hepatic glycogen synthesis doc

Báo cáo khoa học

... inhibitors indicates that insulin activates glycogen synthase by mechanisms additional to inactivation of GSK-3 This can be explained, at least in part, by the inactivation of phosphorylase by insulin ... greater than with insulin alone, consistent with the partial inactivation of GSK-3 by insulin The rates of glycogen synthesis in the combined presence of GSK-3 inhibitors and insulin were the same ... phosphatase This reverses the inhibition of synthase phosphatase by phosphorylase a There is a long-standing debate as to whether inactivation of phosphorylase is a component of the mechanism by...
  • 9
  • 381
  • 0
báo cáo hóa học:

báo cáo hóa học:" Sang Froid in a time of trouble: is a vaccine against HIV possible?" pot

Hóa học - Dầu khí

... routes of administration, for example priming with oral vaccination and following with parenteral boost Moreover, it is not impossible to consider mixed intranasal and intrarectal administration ... that are highly efficacious They are almost always needed for inactivated vaccines, e.g tetanus, diphtheria, and polysaccharide conjugates (exceptions are hepatitis A and hepatitis B), and are often ... retained pathogenicity for the infant intestine, causing diarrhea and fever [10] This problem was solved in my former laboratory by substituting a bovine rotavirus as vector, and in another lab,...
  • 12
  • 419
  • 0
báo cáo khoa học:

báo cáo khoa học: " The NAC domain-containing protein, GmNAC6, is a downstream component of the ER stress- and osmotic stress-induced NRP-mediated cell-death signaling pathway" pptx

Báo cáo khoa học

... Kamiya A, Nakajima M, Enju A, Sakurai T, Satou M, Akiyama K, Taji T, YamaguchiShinozaki K, Carninci P, Kawai J, Hayashizaki Y, Shinozaki K: Monitoring the expression profiles of 7000 Arabidopsis ... NRP -A and NRP-B, an ubiquitin-associated (UBA) protein homolog and NAC (NAM, ATAF1, ATAF2 and CUC2) domaincontaining proteins NAC proteins are plant specific transcriptional factors that are involved ... integrating pathway, also called the integrated pathway The enhanced accumulation of membrane-associated NRPs activates a cascade to induce the expression of the nuclear transactivator, NAC6, which, in...
  • 14
  • 254
  • 0
Báo cáo y học:

Báo cáo y học: " Colour of sputum is a marker for bacterial colonisation in chronic obstructive pulmonary disease" pps

Báo cáo khoa học

... participated in the analysis and interpretation of data AM and SV recruited the patients, collected data and participate in the design and analysis CR participated in the design and analysis of the ... Different reasons may explain this finding, including a small number of patients with valid samples for analysis, the inter-individual variability in the sputum concentrations of the cytokines was very ... speculate that change in bacterial load was unlikely to be a major primary mechanism of exacerbation induction in COPD [27,28] This hypothesis is a matter of debate, because the interpretation of...
  • 9
  • 395
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Intrapulmonary percussive ventilation in acute exacerbations of COPD patients with mild respiratory acidosis: a randomized controlled trial [ISRCTN17802078" ppt

Báo cáo khoa học

... the stable state Statistical analysis The primary outcome variable was the avoidance of a worsening of the acute exacerbation leading to decompensation, defined by a pH < 7.35, and so the need ... t-test Repeated-measures analysis of variance was used to compare the partial pressure of arterial oxygen, PaCO2, RR, and bicarbonate values measured at base line and at the end of the first IPV ... the impact of IPV in the management of patients with acute exacerbations of COPD Key messages • IPV led to a significant decrease in respiratory rate, an increase in PaO2 and a decrease in PaCO2...
  • 8
  • 320
  • 0
Glial cell line drived neurotrophic factor (GDNF) family of ligands is a mitogenic agent in human glioblastoma and confers chemoresistance in a ligand specific fashion

Glial cell line drived neurotrophic factor (GDNF) family of ligands is a mitogenic agent in human glioblastoma and confers chemoresistance in a ligand specific fashion

Cao đẳng - Đại học

... primary brain tumours such as oligodendroglioma or ependymoma as this will impact on adjuvant therapy such as radiation therapy and chemotherapy The mainstay of therapy is a combination of surgery, ... definitive diagnosis and can certainly not provide histological proof of the disease Tissue diagnosis is therefore extremely critical as the radiological appearance of malignant astrocytoma may be mimicked ... increase the risk of brain tumours Particularly, the use of radiation therapy to treat children with tinea capitis in Eastern European have demonstrated increased incidence of meningiomas, gliomas and...
  • 203
  • 290
  • 0
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

Báo cáo khoa học

... ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTG GCGAAGCTTCACGATGTCTCACACCATTT GCGGGATCCCGTTTCCCAGCCTGTTGGGCCT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT ... GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC GCGGGATCCCTGGACGGGCAGCCGATGAAG ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT GCGGGATCCCAGCCCATCCTGCTGCGGCTG ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT ... AAACTGCAGAAGCTTGATTTTGAATTCTGT GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT...
  • 14
  • 517
  • 0
Báo cáo khoa học: The Cockayne syndrome group B protein is a functional dimer docx

Báo cáo khoa học: The Cockayne syndrome group B protein is a functional dimer docx

Báo cáo khoa học

... oligomer The Hill coefficient of 2.1 suggested that at least two binding sites participate in the catalytic activity This is similar to results obtained for the ATPase activity of MJ0796, an ATP-binding ... a predicted subunit molecular mass of 168 kDa, this indicates that CSB is a dimeric protein DNA was not present in these fractions since the ATPase activity was only detectable after the addition ... helicase but as a chromatin remodeller? In this case it can be speculated that the presence of multiple DNA and protein binding sites due to dimerization of CSB in the same manner increases the...
  • 9
  • 273
  • 0
báo cáo hóa học:

báo cáo hóa học:" The biomechanical analysis of three plating fixation systems for periprosthetic femoral fracture near the tip of a total hip arthroplasty" docx

Hóa học - Dầu khí

... testing, and statistical analysis RZ did the literature search, manuscript writing, figure preparation, and statistical analysis MTN engaged in both specimen preparation and mechanical testing ... remaining situations This suggests that when maximal stability is required for periprosthetic fracture fixation, a plating system using proximal and distal screw fixation is one option for the ... replacing proximal cables with proximal unicortical screws in the vicinity of a THA can create stress risers in local bone leading to refracture [9] The increased strength afforded by cortical...
  • 8
  • 336
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Cisplatin chemotherapy (without erythropoietin) and risk of life-threatening thromboembolic events in carcinoma of the uterine cervix: the tip of the iceberg? A review of the literature" docx

Báo cáo khoa học

... to the literature then, formation of severe or life threatening thromboses associated with cisplatin chemotherapy, in the absence of erythropoietin, is an exceedingly rare event The data in table ... injury and possible alterations in the clotting cascade, chemotherapy agents such as cisplatin have the ability to affect coagulability and cause vascular injury, two aspects of Virchow's triad Thus, ... the true incidence of thromboses is established can we better evaluate the therapeutic ratio of cisplatin therapy with or without novel agents such as erythropoeitin Also, this will allow the implementation...
  • 4
  • 325
  • 0
Báo cáo y học:

Báo cáo y học: "Antinuclear antibodies in healthy people: the tip of autoimmunity’s iceberg? David S Pisetsky1,2" pot

Báo cáo khoa học

... extensive analysis of the serology of various racial and ethnic groups would be informative, as would the study of populations in other locales [8] As shown in this and other studies, ANA reactivity is ... very early therapy The road to that Page of point will be long but the study by Li and colleagues is a very promising start of the journey Abbreviations ANA, antinuclear antibody Competing interests ... determinants of the interferon signature, which has been linked to immune complexes composed of ANAs In the real world of patient care, when confronting a positive ANA in a patient without clinical...
  • 2
  • 224
  • 0
Statistical training of researchers in total quality management: The japanese experience

Statistical training of researchers in total quality management: The japanese experience

Ngân hàng - Tín dụng

... analysis, ANOVA, analysis of categorical data, analysis of survival data, dose-response analysis, sample size determination, meta-analysis, statistical guideline for regulation Data Management in ... be aware of the stage he or she is in the stream of R & D This implies the necessity of an in- company training course at least in the final stage of education of applied statistics, and also suggests ... analysis Multivariate Analysis (2) (7.5 hrs.×4 days): Latent structure analysis of categorical data, graphical modelling, canonical correlation analysis, covariance structure analysis integrating...
  • 12
  • 714
  • 0
How group work is used in speaking lesson of the first year major students of english at viet nam university of commerce

How group work is used in speaking lesson of the first year major students of english at viet nam university of commerce

Thạc sĩ - Cao học

... found in the changes in the British language teaching tradition Communicative Language Teaching (CLT) marks the beginning of a major innovation within language teaching for its widely accepted principles ... language Additionally, in the speaking class, if the right activities are taught in the right way, speaking can be a lot of fun, raising general learner motivation and making the English language classroom ... implementation during speaking lesson 3.6 Data analysis The data of the study was analysed both quantitatively and qualitatively As for quantitative analysis, we used descriptive statistics to quantify...
  • 42
  • 1,864
  • 4
A research proposal submitted  in partial fulfillment of the requirements for the degree of Master of Business Administration

A research proposal submitted in partial fulfillment of the requirements for the degree of Master of Business Administration

Quản trị kinh doanh

... Philippines; Macro is in Thailand and Taiwan, Carrefour from France is in Taiwan; and Wellcome is in Taiwan, Hong Kong, Mainland China and Singapore Major Japanese department stores are in most Asian cities ... outlets are mushrooming all over the country’s main cities at an unprecedented growth rate And in Indonesia, the changing spending patterns within the Jakarta area are contributing to an increase in ... quality of merchandise This characteristic was considered the top essential in choosing shopping places with its mean value was as high as 4.74 and 80% of respondents rated this criteria at The...
  • 51
  • 1,039
  • 3
The “advantage of latecomer” in abating air-pollution: the East Asian experience

The “advantage of latecomer” in abating air-pollution: the East Asian experience

Quản trị kinh doanh

... Thiết kế hai nhóm để so sánh quan hệ nhân Hai nhóm đối tượng: Các nước cơng nghiệp h a thời kỳ (Hàn Quốc, Philippines, Sing) nước cơng nghiệp h a muộn (Indonesia, Malaysia, Thái Lan) Quan hệ nhân ... phân tích khí thải SO2 từ quốc gia Đông Á: Nhật Bản, Đài Loan, Trung Quốc, Hàn Quốc, Singapore, Indonesia, Malaysia Thái Lan qua công thức: EM= a + bY+ cY2 + dEF + eIS + fD1 + gD2 + u  Với EM: đại ... thuyết: Air pollution Environmental management (Ơ nhiễm khơng khí) (Sự quản lý môi trường) “Advantage of late comer” (Lợi người sau) Mơn Phương pháp nghiên cứu Khoa học Nhóm * Mơ hình thực tế: Air...
  • 15
  • 516
  • 0

Xem thêm