for pronunciation we have to practice more and more first in individual words in a phrase and then in a sentence we should choose a friend to listen to our speaking so they can correct the mistakes in our saying
Báo cáo y học: "Vitamin supplementation for prevention of mother-to-child transmission of HIV and pre-term delivery: a systematic review of randomized trial including more than 2800 women" potx
... of the trials can be found in table (additional file 1) with regards to: the intervention; standards of care for all participants; the number of mothers randomized and the gestational period in ... at antenatal clinics between 12 and 27 weeks of pregnancy were randomized to receive (i) vitamin A alone or matching placebo and, (ii) multivitamins excluding vitamin A or matching placebo 985 ... are also provided in Table in the section on vitamin A In a parallel group randomized trial in Durban, South Africa, Coutsoudis et al randomized 728 pregnant HIV infected women to either placebo...
- 7
- 392
- 0
An organizational framework and strategic implementation for system-level change to enhance research-based practice: QUERI Series potx
... of formative evaluation [3], and ▪ Plans action during the study, as needed based on formative data, to refine the change intervention, resolve mutable barriers, and enhance available facilitators, ... Coordinator and a Clinical Coordinator, all QUERI Centers were required to have an Implementation Research Coordinator (IRC)[12] Individuals in this role typically possess a doctoral degree in a social ... developing entirely new databases and informatics tools, validating and refining existing databases, and analyzing and interpreting their contents [p, 348, [29]]." Provision of requested research-related...
- 11
- 216
- 0
báo cáo khoa học: " An organizational framework and strategic implementation for system-level change to enhance research-based practice: QUERI Series" pdf
... of formative evaluation [3], and ▪ Plans action during the study, as needed based on formative data, to refine the change intervention, resolve mutable barriers, and enhance available facilitators, ... Coordinator and a Clinical Coordinator, all QUERI Centers were required to have an Implementation Research Coordinator (IRC)[12] Individuals in this role typically possess a doctoral degree in a social ... developing entirely new databases and informatics tools, validating and refining existing databases, and analyzing and interpreting their contents [p, 348, [29]]." Provision of requested research-related...
- 11
- 506
- 0
skkn Motivating students to practice listening skill through English songs to decrease students’ tense while listening, make them feel more interested in listening and enrich their vocabulary
... students’vocabulary and they felt motivated to listening Listening tasks did increase the students’ 15 engagement in class and they were eager to take part in these activities due to the fact that they ... / phrasal verbs was given a to the students again to check if their vocabulary increased or if they gained any vocabulary after they listened to the songs ( The vocabulary / idioms / phrasal verbs ... and some new vocabulary of the song - The teacher let them listen to the song again and asked them sing along with the record - The teacher asked them to sing the song without listening to the...
- 36
- 556
- 1
10240 to be and to have got revision more questions part 3 2 pages 4 exercises with key
... homework have we got? 7) The dog has got a red ball What colour ball has the dog got? 8) We have got History on Friday When have we got History? 9) Mary’s brother has got a mug Whose brother has got ... colour are your eyes? 7) Tony has got a swing in the garden Where has Tony got a swing? 8) Her sister has got birthday today When has her sister got birthday? 9) Jane and Kate are in the bathroom ... trainings four times a week How often / How many times have Paul and Tom got football trainings? 4) There is a lot of chocolate here How much chocolate is there here? 5) The children have got a...
- 5
- 285
- 0
Optimal cost and allocation for UPFC using HRGAPSO to improve power system security and loadability
... algorithm, and enhances searching ability The global best individual can be achieved by the RGA or by PSO, also it can avoid the premature convergence in PSO 4.3 Hybrid of RGA and PSO (HRGAPSO) ... optimization and standard genetic algorithm, some improved mechanisms based on non-linear ranking selection, crossover and mutation are adapted in the genetic algorithm, and dynamical parameters are ... co-author of about 18 papers in international journals and national and international conferences E-mail address: tawfik.guesmi@istmt.rnu.tn Hsan HADJ ABDALLAH was born in Sfax (Tunisia) in 1958...
- 16
- 547
- 0
Tài liệu Must and have to & Must, musn’t, needn’t pptx
... dùng have to cho I had to go to the hospital (past) Tôi phải đến bệnh viện Have you ever had to go to hospital? (present perfect) Bạn phải bệnh viện ch a? I might have to go to hospital (infinitive ... not working tomorrow, so I don’t have to get up early Sáng mai không làm việc, dậy sớm D Bạn dùng have got to thay cho have to Vì bạn nói: I’ve got to work tomorrow hay I have to work tomorrow ... George had to go out He thought it was going to rain, so he decided to take the umbrella George phải Anh nghĩ trời m a, nên anh định mang dù theo I needn’t have brought the umbrella (Lẽ ra) Tôi...
- 6
- 929
- 5
An analysis of errors made by vietnamese secondary school students in using english modal auxiliary verbs can, could, may, must and semi auxiliary verb have to
... native language influences on the learning of a second language is called intralingual by Weinreich at first, and then intralingual by Selinker Language transfer (Selinker, 1969) makes intralingual ... the students gave the wrong answer Instead of using may, they used can As reviewed in chapter 1, may and can can be used to express permission but may is more formal than can and is appropriate ... the learner' disposition to transfer the forms and the meanings, the distribution of forms and meanings of their native language and to the foreign language and culture To sum up, Interlingual...
- 51
- 755
- 0
Applying communicative activities for 10th form students to practise grammatical structures orally at free practice stage
... reasons why they use their mother tongue Because they want to communicate something important and so they use language in the best way they know They will almost certainly find speaking in their ... usually including an example and if appropriate, being written in learners mother tongue - be clear and attractive to look at: have a balanced and varied layout, using underlining and other forms ... very far well they have mastered the material they have been learning and where they are (in order to know where to go next) and so that they will try harder to get further success For the teachers,...
- 50
- 533
- 1
Báo cáo " A brief comparison of Vietnamese intonation and English intonation and its implications for teaching English intonation to Vietnamese EFL learners " pptx
... valuable awareness raising strategy; they may well hear features of their intonation that they simply not have time to notice when actually speaking As a result, they may be able to work on weak areas ... statements, grammatical subordination Fourth, intonation can signal to the listener what is to be taken as “new” information and what is already “given”, can suggest where the speaker is indicating ... unit Third, intonation can help the listener recognize the grammar and syntactic structure of what is being said by using the information contained in the intonation: phrases, clauses, sentences,...
- 10
- 1,968
- 17
Báo cáo khoa học: N-Glycosylation is important for the correct intracellular localization of HFE and its ability to decrease cell surface transferrin binding pptx
... protein is organized into a1 , a2 and a3 structural domains that resemble those described for MHC class I and related proteins [4,16] The N-terminal a1 and a2 domains come together to form a superstructure ... pEP7–HFE-N11 0A HA plasmid The HFE NN130/234AA mutant was made by introducing the N23 4A mutation into the pEP7–HFE-N13 0A HA plasmid The HFE NN234/110AA mutant was made by introducing the N11 0A mutation into ... HFE-NN110/130AA–HA, HFE-NN130/234AA–HA or HFENN234/110AA–HA protein were incubated for 16 h in the presence or absence of mM tunicamycin as indicated (Tunica) HA-tagged proteins in cleared cells lysates were...
- 16
- 538
- 0
corporate social responsibility – csr some theoretical problems and demand for managing changes related to csr in vietnam.
... Secondary data is the data that have been already collected by and readily available from other sources That data are cheaper and more quickly obtainable than the primary data and also may be available ... between me and many managers, accountants and consumers 3.3 Data source To meet the information needs, there is necessary to gather both secondary data and primary data 3.3.1 Secondary data Secondary ... CSR came into Vietnam The research also takes a look on the performance of companies on CSR issue Then, prepare the awareness of management and the reality they apply CSR into their business Moreover,...
- 66
- 701
- 3
The NCI Strategic Plan for Leading the Nation To Eliminate the Suffering and Death Due to Cancer pdf
... preclinical research data with a comprehensive database of clinical trial results to coordinate and optimize information and data sharing This integration and support for the preclinical and clinical ... expanding access to data, investigating behavioral and sociocultural influences on cancer outcomes and access to care, and better understanding how to disseminate the results of research and ... routine screening and removed at an early stage However, the screening rate for colorectal cancer lags far behind that of other cancers, and the disease remains the second leading cause of cancer...
- 81
- 729
- 0
Data Mining Classification: Basic Concepts, Decision Trees, and Model Evaluation Lecture Notes for Chapter 4 Introduction to Data Mining pptx
... data set is divided into training and test sets, with training set used to build the model and test set used to validate it © Tan,Steinbach, Kumar Introduction to Data Mining Illustrating Classification ... Determine when to stop splitting © Tan,Steinbach, Kumar Introduction to Data Mining 46 Stopping Criteria for Tree Induction Stop expanding a node when all the records belong to the same class Stop ... than one tree that fits the same data! 10 © Tan,Steinbach, Kumar Introduction to Data Mining Decision Tree Classification Task Decision Tree © Tan,Steinbach, Kumar Introduction to Data Mining Apply...
- 101
- 4,291
- 1
Data Mining Association Analysis: Basic Concepts and Algorithms Lecture Notes for Chapter 6 Introduction to Data Mining pdf
... store the candidates in a hash structure • Instead of matching each transaction against every candidate, match it against candidates contained in the hashed buckets © Tan,Steinbach, Kumar Introduction ... structures to store the candidates or transactions – No need to match every candidate against every transaction © Tan,Steinbach, Kumar Introduction to Data Mining 11 Reducing Number of Candidates Apriori ... Data Mining 15 Reducing Number of Comparisons Candidate counting: – Scan the database of transactions to determine the support of each candidate itemset – To reduce the number of comparisons, store...
- 82
- 3,876
- 0
Data Mining Association Rules: Advanced Concepts and Algorithms Lecture Notes for Chapter 7 Introduction to Data Mining docx
... © Tan,Steinbach, Kumar Introduction to Data Mining Handling Categorical Attributes Transform categorical attribute into asymmetric binary variables Introduce a new “item” for each distinct attributevalue ... sequences – Candidate Elimination: • Eliminate candidate k-sequences whose actual support is less than minsup © Tan,Steinbach, Kumar Introduction to Data Mining 35 Candidate Generation Base case (k=2): ... will increase dramatically because we need to perform more passes over the data – May miss some potentially interesting cross© Tan,Steinbach, Kumar Introduction to Data Mining 25 level association...
- 67
- 3,366
- 1
Data Mining Cluster Analysis: Basic Concepts and Algorithms Lecture Notes for Chapter 8 Introduction to Data Mining pot
... tree © Tan,Steinbach, Kumar Introduction to Data Mining Partitional Clustering Original Points © Tan,Steinbach, Kumar A Partitional Clustering Introduction to Data Mining Hierarchical Clustering ... Data Mining 36 Bisecting K-means Bisecting K-means algorithm – Variant of K-means that can produce a partitional or a hierarchical clustering © Tan,Steinbach, Kumar Introduction to Data Mining ... Incrementally In the basic K-means algorithm, centroids are updated after all points are assigned to a centroid An alternative is to update the centroids after each assignment (incremental approach)...
- 104
- 2,209
- 0
Data Mining Cluster Analysis: Advanced Concepts and Algorithms Lecture Notes for Chapter 9 Introduction to Data Mining pot
... Introduction to Data Mining 13 Chameleon: Clustering Using Dynamic Modeling Adapt to the characteristics of the data set to find the natural clusters Use a dynamic model to measure the similarity between ... cluster the data is drastically reduced The size of the problems that can be handled is increased © Tan,Steinbach, Kumar Introduction to Data Mining Graph-Based Clustering: Sparsification … Clustering ... cluster if they share more than 10 near neighbors © Tan,Steinbach, Kumar Introduction to Data Mining 28 When Jarvis-Patrick Works Reasonably Well Original Points Jarvis Patrick Clustering shared neighbors...
- 37
- 703
- 0
Báo cáo khoa học: Soluble recombinant CD69 receptors optimized to have an exceptional physical and chemical stability display prolonged circulation and remain intact in the blood of mice doc
... the following primer pairs: for CD69NG70, 5¢-ACATATGGGCCAATACACATTC-3¢ and 5¢-ACAAAGCTTATTTGTAAGGTTTGTTACA-3¢; for CD69NV82, 5¢-ACATATGGTTTCTTCATGCTCTG-3¢ and 5¢- ACAAAGCTTATTTGTAAGGTTTGTTACA-3¢; ... proteins and allow us to select the human protein containing amino acids Gly70 to Lys199 (and the rat and mouse orthologs) as the most physically and biochemically stable variant We have proven an ... ACAAAGCTTATTTGTAAGGTTTGTTACA-3¢; and for CD69NS84, 5¢-ACATATGTCATGCTCTGAGGACTGG GTT-3¢ and 5¢- ACAAAGCTTATTTGTAAGGTTTGTT ACA-3¢ PCR products were directly cloned into pBSK+ cloning vector (Stratagene, LaJolla, CA, USA) using...
- 18
- 400
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25