figure 1 22 free body diagram of drill bit in example 1 6 a with shear stress b

Báo cáo khoa học: Crystal structures of the human SUMO-2 protein at 1.6 A and 1.2 A resolution ppt

... (SMT3) 16 /b> –88 (SUMO-2) 16 /b> –88 12 –89 12 –89 16 /b> –87 17 –87 17 –87 17 –88 Water Resolution 38 67 67 10 2 10 2 12 7 3.0 2.0 1. 6 1. 6 1. 5 1. 5 1. 2 1. 2 1. 2 ˚ A ˚ A ˚ A ˚ A ˚ A ˚ A ˚ A ˚ A ˚ A R/Rfree 0. 464 0.339/0.3 71 ... (hexagonal indexing) a ¼ b ¼ 74. 96, c ¼ 33.23 NSRRC BL1 7B2 1. 0 717 RAXIS-IV+ + 83.4 1. 5 0.292 14 5 20 1. 2 (1. 24 1. 20) 14 1402 (11 874) 217 81 ( 210 9) 10 0.0 (99.8) 39 .6 (2 .6) 4 .6 (55.9) CNS 1. 1 7 868 (63 3) ... has been Type II R3 (hexagonal indexing) a ¼ b ¼ 75.25, c ¼ 29 .17 MicroMax 002 1. 5 418 RAXIS-IV+ + 10 0 1. 0 0. 61 4 18 6 50 1. 6 (1. 66 1. 60 ) 42023 ( 212 0) 8 015 (69 0) 98.5 (85 .1) 45.5 (5.3) 3.9 (24 .6) ...

Báo cáo khoa học: Molecular basis for substrate recognition and drug ˚ resistance from 1.1 to 1.6 A resolution crystal structures of HIV-1 protease mutants with substrate analogs pptx

Danh mục: Báo cáo khoa học

... P 212 12 p6pol-PR P 212 12 p6pol-PR P 212 12 p1-p6 P 212 12 p1-p6 P 212 12 57.89 85. 96 46 .19 50 1. 54 34 544 6. 5 (37 .1) 13 .4 (5.8) 10 1. 54 0 .12 0 .19 19 4 58.00 85.78 46. 53 50 1. 40 44 2 91 10 .1 (45 .6) 8.9 (2 .1) ... Goodenow MM (19 96) Natural variation in HIV -1 protease, Gag p7 and p6, and protease cleavage sites within Gag ⁄ Pol polyproteins: amino acid substitutions in the absence of protease inhibitors in mothers ... Soc 11 7, 11 867 11 878 36 Silva AM, Cachau RE, Sham HL & Erickson JW (19 96) Inhibition and catalytic mechanism of HIV -1 aspartic protease J Mol Biol 255, 3 21 3 46 37 Wondrak EM & Louis JM (19 96) In uence...

Structural basis of protein stability at poly extreme crystal structure of amya at 1 6 a resolution

Danh mục: Cao đẳng - Đại học

... crystalline lattice (real space) The following geometrical interpretation of diffraction was formulated by Ewald 14 0 b* 13 0 12 0 N ( 010 ) 11 0 b O (13 0) y (12 0) x (11 0) Figure 1. 2 The reciprocal lattice ... projection of F on the Imaginary imaginary axis is its imaginary part iB, a vector of length |B| i |B| Real F α |A| Figure 1. 4 Real and imaginary components of the structure factor From the above figure ... defined as a group of points organized in space in such a way that each point has the same environment There are 14 types of unit-cells in crystallography that lead to 14 Bravais lattices The Bravais...

Structural basis of protein stability at poly extreme crystal structure of amya at 1 6 a resolution 3

Danh mục: Cao đẳng - Đại học

... A protein concentration of 0 .1 mg ml -1 (determined by the Bradford assay method) was used for wavelength scans For wavelength scans, a scan rate of 10 nm min -1 was used with a time constant of ... AmyA that was pre-incubated for 30 minutes in the complete absence of NaCl in boiling water still retained its activity (Fig 3.2) Figure 3.2 Activity of AmyA after temperature melt Activity assay ... assay of AmyA at different NaCl concentration before and after the incubation of the AmyA sample in boiling water for 30 minutes Addition of as low as mM NaCl or CaCl2 to this solution decreased...

Structural basis of protein stability at poly extreme crystal structure of amya at 1 6 a resolution 4

Danh mục: Cao đẳng - Đại học

... 3 .13 ASP-330-OD1 - ARG-379-NH2 2.84 Network No Participating residues Distance in Å ASP -12 8-OD1 - ARG -222 -NH1 3.52 ASP -12 8-OD2 - ARG -222 -NH1 2.97 ASP -224 -OD1 - ARG -222 -NH1 2 .65 ASP -224 -OD2 - ARG -222 -NH1 ... aromatic amino acid interactions are known to be one of the determinants of thermal stability in thermophilic proteins (Kannan and Vishveshwara, 2000; Serrano et a. , 19 91) A pair of aromatic interactions ... Å The active site 72 of hAmyA is better superimposed with that of other known α-amylase structures than that of lAmyA In lAmyA, the main chain and side chain of the catalytic residue Asp224 protrude...

Structural basis of protein stability at poly extreme crystal structure of amya at 1 6 a resolution 2

Danh mục: Cao đẳng - Đại học

... 51 Figure 2 .11 Calcium binding loop A stick and ribbon model representation of a calcium binding loop Side chains of the amino acids that make coordination bonds with the calcium are shown as ... other α-amylases at the interface between domains A and B are missing in AmyA Figure 2 .10 A stereo view of calcium binding A stereo representation of a calcium binding loop is shown with the ... calculated by using the TIM barrel domain of maltogenic amylase (Protein Data Bank accession code 1SMA) and the model was adjusted by using O (Jones, et al, 19 91) Subsequently, the C domain was...

Immobilization of heavy metals in sediment dredged from a seaport by iron bearing materials

Danh mục: Môi trường

... container should be labeled appropriately and indicated to be a biohazard material” etc In addition to that, there should be one department in each hospital responsible for managing the waste classification ... management” of the Ministry of Public Health, medical waste must be treated immediately at once, contained in bag or barrel according to color and standard In fact, in most hospitals, especially ... medical wastes in Vietnam Public economics had manual incinerator In other hospitals, the manual incinerator is burned and leaves an uncomfortable smell According to the “Regulation of medical waste...

INFLUENCE DISTRIBUTIONS OF ACID DEPOSITION IN MOUNTAINOUS STREAMS ON A TALL CONE-SHAPED ISLAND, YAKUSHIMA

Danh mục: Môi trường

... features are caused mainly by the shape and isolation of the island REFERANCE Ebise S (19 96) Estimation on effects of acid rain by observation of mountainous river waters during dry-weather day ... total organic carbon, dissolved SiO2, inorganic cations and anions were measured as water quality indicators INFLUENCE PATTERNS OF ACID DEPOSITION Yakushima (area of 503 km2) is a tall, circular, ... of alkalinity, pH and EC in the small streams flowing into the north branch stream were lower (e.g 40 % in alkalinity) than those in the south branch The concentrations of almost all cations and...

Tài liệu Báo cáo "Numerical simulations of overland floods in urban areas using a conservative Godunov-type scheme " pptx

Danh mục: Báo cáo khoa học

...

Tài liệu Báo cáo khoa học: Insulin-dependent phosphorylation of DPP IV in liver Evidence for a role of compartmentalized c-Src ppt

Danh mục: Báo cáo khoa học

... Inter-alpha-inhibitor H4 heavy-chain SAPAP-3 DPP IV, membrane-bound form precursor BIP ER -60 protease Hemopexin Beta -1 adducin 19 21 14 29 12 24 19 8 64 0 ⁄ 18 0 000 15 9 420 ⁄ 220 700 10 3 930 ⁄ 11 7 ... Machamer CE & Hubbard AL (19 92) Rat liver dipeptidylpeptidase IV contains competing apical and basolateral targeting information J Biol Chem 267 , 222 82 222 88 Casanova JE, Mishumi Y, Ikehara Y, ... were washed out (Fig 4B) A number of proteins ‘disappeared’ following treatment with proteinase K alone while the 66 -kDa albumin was protected The 66 -kDa albumin band almost completely disappeared...

Enterprise Adjustment and the Role of Bank Credit in Russia: Evidence from a 420 Firm''''s Qualitative Survey pdf

Danh mục: Ngân hàng - Tín dụng

... not with certainty See Qian (19 94), Dewatripont and Maskin (19 95), Earle and alii (19 96) , Earle and alii (19 97), Berglửf and Roland (19 98), Bai and Wang (19 98) For an analysis of the shortcomings ... of real wages as well as of wage arrears However, a remarkable point is that a substantial proportion of firms ( 31. 5% of the sub-sample) has increased their headcount, most often marginally but ... Left-hand half Total sample Debt =1) : probability of an increase in indebtedness 20,38% 24,47% 18 ,58% Debt=2): probability that indebtedness remains the same 31, 59% 27,82% 31, 80% Debt=3): probability...

Báo cáo Y học: Functional assignment of motifs conserved in b1,3-glycosyltransferases A mutagenesis study of murine UDP-galactose:b-N-acetylglucosamine b1,3-galactosyltransferase-I pptx

Danh mục: Báo cáo khoa học

... AAATGAGCCCAACAAAGCCGAGAAAAACATT AATTTGATGCTCGACAGGCTGCCGCGGAGACATGG CAATCCGGGAGACAGCTGGTGATGAAAA TAGCCACACTTGCAGCCGCGGCCAAAAATG TTAATGGGGATGAGAGCGGTTGCCACTTTCT AGATGGGTTGGCAACTTTCGCTTCAAAA TGAAAACCGCCAGTGCTATTGCTGTGAACA ... site-containing primer Mutation Oligonucleotide sequence (5¢)3¢) C7 3A I9 7A- R9 8A W10 1A F 1 16 /b> A- L 117 A- L 118 A- G 119 A W 162 A C 167 A D17 7A- D17 9A- F18 1A P23 3A- P23 4A C23 6A E 264 A C27 1A C29 5A W 315 A C32 6A AAATGAGCCCAACAAAGCCGAGAAAAACATT ... GlcNAcb-pNP and GalNAcb-pNP UDP-Gal UDP-GlcNAc UDP-GalNAc GlcNAcb-pNP Sf9mock b3 GalT-I C7 3A I9 7A- R9 8A W1 01 F 1 16 /b> A- L 117 A- L 118 A- G 119 A W 162 A C 167 A D17 7A- D17 9A P23 3A- P23 4A C23 6A E 264 A C27 1A C29 5A W 315 A...

Báo cáo khoa học: The sulfur atoms of the substrate CoA and the catalytic cysteine are required for a productive mode of substrate binding in bacterial biosynthetic thiolase, a thioester-dependent enzyme doc

Danh mục: Báo cáo khoa học

... (83 .6) 10 .0 (23.2) 2.8 (2.2) 25 P 21 84.4, 79.0, 14 8.8 90, 93.0, 90 23 .1 28 .6 0. 011 1. 2 1. 0,2.0 21. 6 24.9 0. 014 1. 4 1. 5 ,1. 7 19 .4 22. 9 0. 018 1. 6 1. 4,2.7 22. 2 26. 2 0.009 1. 1 0.7 ,1. 3 16 /b> .1 21. 2 0. 014 ... Cys89) Beamline ˚ Wavelength (A) Data processing ˚ Resolution range (A) EMBL ⁄ DESY X13 0. 81 EMBL ⁄ DESY BW 7B 0.84 EMBL ⁄ DESY X 11 0. 81 EMBL ⁄ DESY X13 0. 81 Rotating anode 1. 5 418 20–2 .65 (2.72–2 .65 ) ... The magnitude of the unfavorable DDH term indicates that the sulfur– A B Fig Calorimetric analysis of CoA binding by (A) wild-type and (B) C8 9A thiolase Curve ﬁtting in both cases was carried...

MECHANISMS OF AESTHETIC EXAPTATION IN ARTEFACT DESIGN: HOW A BEAUX-ARTS GARDEN EVOLVED INTO AN AVANT-GARDE ART PARK pptx

Danh mục: Mỹ thuật

... Mechanisms of Aesthetic Exaptation in Artefact Design: How a Beaux-arts Garden evolved into an Avant-garde Art Park Abstract The concept of exaptation – the co-optation of a feature for ... resulting from radical innovation processes (Grandori 200 7a; Kogut 2007 )1 In both biological and artificial settings, innovation-by-exaptation has been contrasted to innovation-byadaptation, ... transformed into offices, factories into lofts, carwash locales hosting art galleries; urinals as artistic fountains in museums (Duchamp 19 17); anarchists’ political symbols as icons of prominent...

Rubber Plantations and Transformations of Akha Society in Xishuangbanna, Southwest China: A Case Study of Baka Village ppt

Danh mục: Lâm nghiệp

... eight natural villages—4 Akha (Baka, Bohe, Pisha, Bahanhuang), Han and Hani (Nasha Yidui, Nasha Erdui, Nasha Sandui), and Buxia (Buxia Huixian) Baka natural village will be my major research site ... Program in early 2000s 10 Table Smallholder’s rubber plantations in Baka village (19 82-20 06) Years of Land plot Tenure of Numbers of Area of rubber Total plantations name the lands rubber plantations ... rubber plantations in Baka village Like we observed in Baka, whole Xishuangbanna is experiencing a fast economic growth mainly due to rubber plantations Increased cash incomes has enabled Baka...

Health of the Elderly in South-East Asia A profile pptx

Danh mục: Sức khỏe người cao tuổi

... (19 91) 14 .3 9.0 (20 01) 11 .8 13 .4 10 .6 (20 01) 15 .3 (19 91) 14 .3 10 .7 (19 96) Year 2005 2 010 2 015 2020 11 .0 (2 0 16 /b> ) 14 .1 NA NA NA NA NA NA 17 .2 9.8 (2 011 ) 12 .8 NA 11 .5 (2 011 ) 20 .1 23.8 NA NA 17 .6 NA ... expectancy of population after 60 years of age, by sex and age range, in Myanmar Year Age range 19 90 19 99 Male Female Male Female 60 -64 urban rural 15 .8 15 .7 17 .3 17 .6 16 /b> .1 16. 0 17 .7 17 .1 65 -69 urban ... per 10 00 population for all ages in India Year Male Female 19 76 19 77 19 78 19 79 -19 81 1984 19 85 -19 89 19 89 -19 91 1993 19 94 19 96 14 .7 14 .0 13 .8 12 .4 12 .4 11 .0 10 .0 9.5 9 .6 9 .1 15.3 15 .3 14 .5 12 .7 12 .8...

báo cáo hóa học: " Occurrence of post traumatic stress symptoms and their relationship to professional quality of life (ProQoL) in nursing staff at a forensic psychiatric security unit: a cross-sectional study" potx

Danh mục: Hóa học - Dầu khí

... experience – Ward cross tabulation years C F Total 0–3 9.5% 18 .2% 31. 3% 18 .2% 13 18 ,6% 14 .3% 18 .2% 18 .8% 18 .2% 12 17 ,1% 7–9 14 .3% 22. 7% 0% 0% 11 ,4% 10 12 4.8% 9 .1% 6. 3% 0% 5,7% over 12 Total N B 4 6 Length ... central and northern parts of Norway with about 1. 1 million inhabitants The unit consists of wards with a total number of 21 beds One of the wards (ward F) is specialised to serve offenders with learning ... http://www.hqlo.com/content/7 /1/ 31 28 26 44 40 22 36 BurnOut Scale Compassion Satisfaction Scale 24 32 28 20 18 16 /b> 14 24 12 10 20 A B C F Wards A B C F Wards Figure scores on CS at the different wards Box plot indicating...

báo cáo hóa học: " Efficacy of motor imagery in post-stroke rehabilitation: a systematic review" ppt

Danh mục: Hóa học - Dầu khí

... http://www.jneuroengrehab.com/content/5 /1/ 8 16 /b> exp cerebral ischemia/(7 91) 15 17 exp cerebral vascular accident/( 914 4) 16 /b> 18 exp brain ischemia 17 19 exp basal ganglia cerebrovascular disease 20 exp cerebral hemorrhage 18 19 21 exp ... reviewers appraised all included trials based on a pre-defined list of selected quality items assessing components of internal validity [19 ] (Table 1) In case of any discrepancy, we obtained the opinion ... demonstrate that during MI sessions partially the same brain areas are as activated as during functional tasks Function, behavior, and performance are rehearsed mentally as if the person is actually...

Báo cáo hóa học: " Inhibition of cytokine gene expression and induction of chemokine genes in non-lymphatic cells infected with SARS coronavirus" doc

Danh mục: Hóa học - Dầu khí

... Virology Journal 20 06, 3 :17 10 11 12 13 14 15 16 /b> 17 18 19 20 21 22 23 24 25 26 Kuiken T, Fouchier RA, Schutten M, Rimmelzwaan GF, van Amerongen G, van Riel D, Laman JD, de Jong T, van Doornum G, ... et al.: Plasma inflammatory cytokines and chemokines in severe acute respiratory syndrome Clin Exp Immunol 2004, 13 6: 95 -10 3 BGoNRPf SARS: Dynamic changes in blood cytokine levels as clinical indicators ... pneumocytes against SARS coronavirus infection in macaques Nat Med 2004, 10 :290-3 Hensley LE, Fritz LE, Jahrling PB, Karp CL, Huggins JW, Geisbert TW: Interferon-beta 1a and SARS coronavirus replication...

báo cáo hóa học:" Functional bracing for delayed union of a femur fracture associated with Paget''''s disease of the bone in an Asian patient: a case report" pot

Danh mục: Hóa học - Dầu khí

... Prevalence and clinical features of Paget's disease of bone in Japan J Bone Miner Metab 20 06, 24 :18 6 -19 0 Takata S, Hashimoto J, Nakatsuka K, Yoshimura N, Yoh K, Ohno I, Yabe H, Abe S, Fukunaga ... Terada M, et al.: Guidelines for diagnosis and management of Paget's disease of bone in Japan J Bone Miner Metab 20 06, 24:359- 367 Kanis JA: Pathophysiology and treatment of Paget's disease of bone ... disease in Australia, New Zealand, North America and most European countries, but it has a low incidence in Scandinavia, and is extremely rare in the Japanese population, with a prevalence of 0 .15 /10 0000;...

Xem thêm

Tìm thêm: khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25

figure 1 22 free body diagram of drill bit in example 1 6 a with shear stress b with equivalent internal torque