... to PageRank, again see [Page 98] Another intuitive justification is that a page can have a high PageRank if there are many pages that point to it, or if there are some pages that point to it and ... with the docID that the anchor points to It also generates a database of links which are pairs of docIDs The links database is used to compute PageRanks for all the documents The sorter takes the ... DARPA and NASA, and by Interval Research, and the industrial partners ofthe Stanford Digital Libraries Project References Best ofthe Web 1994 Navigators http://botw.org/1994/awards/navigators.html...
... 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer containing the ... Ala, upper primer 5¢-d(ATAGATTGGGGTGCCCATGCAAATAA TGCA)-3¢, lower primer 5¢-d(ATTATTTGCATGGGCA CCCCAATCTATTTG)-3¢; Tyr269 to Ala, upper primer Fig Partial alignment of alkaline phosphatases at ... higher than the native cold adapted enzyme (Table 1) The mutant G26 1A/ Y26 9A exhibits an Ea almost the same as in the case ofthe native enzyme (Table 1) Thermal inactivation of mutant and wild-type...
... thousand babies, and the average age among adults living in the area (as a proxy for the demand for health care).16 The first column of Table shows the mean across all areas and years and the standard ... qualifications is associated with a lower decline in uptake However that the authors measure the educational attainment ofthe economically active population rather than that ofthe adult population ... in time Analysis of this data allows us to confirm that there was, at the peak ofthe controversy, a negative education gradient in the uptake ofthe MMR after controlling for a range of other potentially...
... This aspartate interacts with the 2-OH of ADP ribose in a manner similar to that ofthe catalytic glutamate ofthe ADPRT and this could be essential to the mechanism and form part ofthe mechanism ... endosomes, the low pH activates the translocation function ofthe B domain heptamers and they translocate the catalytic A domains across the endosomal membrane into the cytoplasm where they can act ... nearly all ofthe C3-like and Iota-like ADPRTs These are: (a) a tyrosine residue that interacts with the ‘S’ ofthe STS motif and the catalytic glutamate through hydrogen bonds, (b) an asparagine...
... clicks on an ad on a search results page, or follows a link associated with a referral account, the agent arrives at a landing page A landing page is a web page that an advertiser pays a search engine ... to the subsyndicator In effect, in a subsyndication deal, the syndicator acts as a relay or a proxy for the ad network The subsyndicator earns a share ofthe syndicator’s share ofthe CPC paid ... fraud attacks Acknowledgments Thanks to Enrique Gonzalez Ochoa at Panda Software for collaborating during the investigation of Clickbot .A Thanks to Panda Software and RSA for helping investigate...
... performance ofthe ILECs has been by far the worst of any major information technology sector Furthermore, their strategic, managerial, and political conduct have greatly affected the nature and ... Litan, Strobe Talbott, Michael Armacost before him, and Chris Kelaher and all the people at Brookings Institution Press And finally, I must thank the staffs of Balthazar in New York and ofthe cafés ... realize the largest potential gains in these areas, particularly in videoconferencing Broadband issues also have significant national security implications for the United States In the wake of the...
... kinematic data is used for computational assessment and generates the interactive feedback Based on observation and the computational assessment, the clinician may adapt the system extension ofthe ... consistency measure The average variation ofthe maximum speed (within a reach) over a set of ten reaches Reaching time consistency The average variation ofthe maximum reaching time (within a reach) ... during a reach and the reference curve derived from non-impaired reaching data that is scaled to the start and end reference angle of each participant Consistency ofthe angular profile The average...
... tools Acknowledgements The authors thank Barbara Bobranska-Artiuch (University of Calgary), Fatima Chatur (University of Calgary), and Pierre Duez (University of Toronto) for their support in data ... Medical Center, 1403-29th Street NW, Calgary, University of Calgary, Calgary, Alberta, Canada 2University of Toronto, Toronto, Ontario, Canada Authors’ contributions All authors made substantial ... conception and design and to interpretation of data; FK analyzed the data; JH-L contributed to the acquisition of data and drafted the manuscript; All authors were involved in revising the manuscript...
... comparison to a placebo or standard therapy on infection, MOF, and mortality in trauma patients Materials and methods Search Studies were found via computerized searches ofthe MEDLINE and EMBASE ... in the computerized search Quality assessment The methodological quality of each ofthe studies for which the full text was available was assessed using a checklist for therapy articles from the ... to attenuate the early overwhelming inflammatory response and diminish the immune paralysis As many trauma patients are plagued by infections, researchers aimed to augment the host’s inflammatory...
... minimal The data set contains detailed information on each transaction in the sample period, i.e whether the transaction was a market borrow or market lend, the annual interest rate, quantity, and ... trading day Throughout the trading day market participants are trading an asset that only exchanges hands after trading ceases Since a one day repo today is not the same asset as a one day repo ... strategy Journal of Financial and Quantitative Analysis, 31(2):213–231 Hartmann, P., Manna, M., and Manzanares, A (2001) The microstructure ofthe euro money market Journal Money Credit and Banking,...
... consider the relation between earnings management and accruals behavior, and earnings quality and accruals behavior Early studies used the change in Total Accruals as a measure of management discretion ... legitimate asset write-offs and/or impairment charges in the initial year of an auditor-client relationship These write-offs and charges would create large absolute accruals and large negative accruals ... ofthe accruals measures presented in Figure 1; the number of consecutive years that the firm has retained the auditor; the number of years of data available on Compustat since 1980; the log of...
... interpretation ofa 2D sketch into a reality and qualitative data was required When analysing the patterns and the garments, data relied X upon professional judgement from the researcher as the designer ... readymade (De La Haye, 1993) One effect the introduction of commercial patterns and the manufacture of ready-to-wear garments had was less individuality because ofthe standardisation in size and ... systems are capable of storing an incredible amount of data that can be quickly tweaked and refilled There are many benefits to PDS - speed, accuracy and ease of data transmission being some of the...
... suggests an analysis ofthe individual in society, which made the arena of interaction the locus of reality, of socialization, and of societal regeneration Goffman’s work speaks to both roles (the nature ... just the subject matter of this, but also have a highly distinctive attitude and analytical stance towards the social world (Goffman, 1967) According to Adler, Adler, and Fontana (1987), Goffman ... Virtual space is the conceptual space where people manifest their words and human relationships, data, and their wealth and power The “real” juxtaposed against the “virtual” is less important in the...
... dirty pages • Data manager floods the cache This is rather similar in nature to a data manager which fails to free data, but is easier to detect and prevent • Data manager changes data A malicious ... for another thread in that task • Server tasks which cannot tolerate changing data, or which must ensure that all ofthe necessary data is available, may use a separate thread to copy that data ... copied) data in a message • Data manager backs its own data Deadlock may occur if a data manager becomes blocked in a page fault waiting for data which it provides Fortunately, there are several techniques...
... – Advantages • Can carry up to three times the amount of data as TDMA • Transmissions are much harder to eavesdrop on • A would-be eavesdropper must also know the exact chip in which the transmission ... data to be sent – Imprints a unique address on the data – The longer the code is, the more users will be able to share the same channel – Number of chips in the code • Determines the amount of ... Divides the transmission time into several slots – Each user is assigned the entire frequency for the transmission • For a fraction of time on a fixed, rotating basis – Advantages • Uses the bandwidth...
... languages belonged to a third, Nilo-Saharan family, which may have originated in the broad Saharan region at least as early as Afroasiatic Nilo-Saharan may be distantly related to the fourth family, ... taken Carthage a decade later, and extended their power across the region sub-saharan africa Whether Carthage transmitted metalworking to sub-Saharan Africa is one ofthe mysteries of African ... religions, and alphabetic literacy that sub-Saharan Africa partially shared with the Eurasian core Partial isolation meant that cultural phenomena took distinctively African forms Partial integration...
... non-parametric correlations A P value of less than 0.05 was regarded as significant Software package STATA 9.0 (USA) was used for the analysis Materials and Methods Results Hospital setting and antibiotic ... financial cost and resistance patterns of leading nosocomial pathogens (gram) and number of boxes were calculated from two databases, 1) Hospital pharmacy computer databases, and 2) International ... NARP was initiated in Turkey in February 2003 by a central regulation of Ministry of Health and was announced nation-wide via official newspaper ofthe state [11] This is a quasi-experimental...
... this.$el.html(this.template(this.model.toJSON())); } }); How we update the model when checkbox changes? Models & Views View events update the Model Server Data Models Views Provides the Data Update the data } }); ... todoItem.set({status: 'complete'}); Sync to the server todoItem.save(); Configuration needed Introduction 'Pick up milk' Displaying the Data Server Client Data Models Views Provides the data DOM Builds the ... Introducing the Todo App To get the todo data $.getJSON('/todo', function(data) { The data returned { description: 'Pick up milk', status: 'incomplete', id: } Introduction Adding Functionality Checking...