exercise 2 perform a complete session of clinical facial photography
Báo cáo y học: "Excess circulating angiopoietin-2 is a strong predictor of mortality in critically ill medical patients"
... study These data reveal an important limitation for Ang -2 as a quantitative marker for vascular permeability: high Ang -2 might be a surrogate parameter for increased capillary permeability per ... multivariate Cox model In a large trauma cohort study [22 ], Ang2 correlated with mortality in a univariate analysis In a surgical population with ARDS, Ang -2 predicted death with a similar discriminatory ... Angiopoietin -2, marker and mediator of endothelial activation with prognostic significance early after trauma? Ann Surg 20 08, 24 7: 320 - 326 Gallagher DC, Parikh SM, Balonov K, Miller A, Gautam S, Talmor...
- 9
- 634
- 0
A Complete Handbook of Nature Cure docx
... juice of any available seasonable fruit such as apple, pineapple, orange, sweet lime and grapes Breakfast :- Fresh fruits such as apple, orange, banana, grapes, or any available seasonal fruits, a ... Sit in padmasana Do 20 strokes of kapalbhati Inhale and exhale rapidly, making a puffing sound This is a good exercise for abdominal viscera and lungs Sheetali : Sit in padamasana or any other ... the lateral sides of the body Besides, it stimulates the adrenal glands and tones up the abdominal and pelvic organs 22 Pranayama Prana means ‘ vital force ‘ and Ayama means ‘ control ‘ in Sanskrit...
- 265
- 788
- 0
Báo cáo khoa học: A complete survey of Trichoderma chitinases reveals three distinct subgroups of family 18 chitinases potx
... TTCTGCTGCTAGGGAAATAG GACTCTCGAGATCAAGCAC TCTGATTGCGGCTGGTTTC GCAATTGAGAGCAGTTTCG TTGAAGAAGGAGCACGAATGCC AAGAGAAGAGATGGTGGTCC CTCTCACCATCAAAGCCAAAG TCATGTCTAAGAGCATAGGC TGTCCAGTTGCCCGAGTTGA CGGGCTATCTGATCCTCA ... TGCGGCACTCTTGGAGAAG CCAATGCAGTCTATTTCCCTAG AGCCGCAATCAGACTTCG CGTCAACAGTCGCCTTCAGG GCCGATGGCATTGACATTG TACCGCACAACAAAAGGGA TCTTTTAGTTCCAGGAACCTG AAGAAGACCTGGGGCTGGA ATGTAGATGATGTAGTCGAC GTATCTCAAGGGATTCCCCA ... 3Race-13nest AAGCAGTGGTATCAACGCAGAGT ATTCTAGAGGCCGAGGCGGCCGACATG-d(T)30N-1N GAAGATGTGCGTAATATTAGC GTCTTGTCTTTATACACCAGCC GGGAAATGGACTACTACGAG AGCCTGGTACGTAGATGCA ATTGAGCATTCCCGGCGA TTCTGCTGCTAGGGAAATAG...
- 17
- 454
- 0
Guy Fawkes or A Complete History Of The Gunpowder Treason, A.D. 1605 pot
... cellar to Thomas Percy, with the adjoining house, and that the wood and coals were the property of that gentleman At this stage of the examination, the lord chamberlain saw a man standing in a ... and that one of the traitors was already in custody The satisfaction of the people was great at the intelligence, that no danger now existed, and that the king and the parliament were safe Fawkes ... John Grant, Ambrose Rookwood, Robert Keys, and Thomas Bates, were arraigned and placed at the bar on the 27 th of January, 1605-6 The names of Garnet, Tesmond, and Gerrard, all jesuits, were also...
- 74
- 422
- 0
Báo cáo khoa học: Identification of mitogen-activated protein⁄extracellular signal-responsive kinase kinase 2 as a novel partner of the scaffolding protein human homolog of disc-large docx
... (Santa Cruz, CA, USA); anti-MEK2 (ab 325 17), anti-MEK1 (ab 320 91), anti-Raf1 (ab18761), anticalreticulin (ab2907), anti-GM130 (ab 526 49), anti-RSK1 p90 (ab 321 14), anti-N-cadherin (ab1 820 3) and anti-GAPDH ... mutagenic primers were: GRRF-PDZ1: 5¢GAAAGGGGAAATTCAGGGCGTCGT TTCAGCATTGCAGGAGG-3¢; GRRF-PDZ2: 5¢-ATTA AAGGTCCTAAAGGTCGTCGGTTTAGCATTGCTGGA GG-3¢; RAAV-MEK2: 5¢-CACCCACGCGCGCCGCCGT GTGA-3¢ and ... 5¢-GTGGGGAAATATGCTCTTGAGGAGGT-3¢; primers 2, forward: 5¢-GTGACTTCAGAGACACTGCCA-3¢, and reverse: 5¢-CCCTTTCAAGTGTGATTTCTTC3¢; primers 3, forward: 5¢-ACCAGATGGTGAGAGCGAT-3¢, and reverse: 5¢-CTGTCTTTCATAGGTCCCAAT-3¢...
- 11
- 419
- 0
Báo cáo khoa học: Mechanism of mild acid hydrolysis of galactan polysaccharides with highly ordered disaccharide repeats leading to a complete series of exclusively odd-numbered oligosaccharides doc
... G -A- G -A- G -A- G -A- G -A- G G -A- G -A- G -A- G -A- G -A- G -A- G G -A- G -A- G -A- G -A- G -A- G -A- G -A- G G -A- G -A- G -A- G -A- G -A- G -A- G -A- G -A- G G -A- G-Aol G -A- G -A- G-Aol G -A- G -A- G -A- G-Aol G -A- G -A- G -A- G -A- G-Aol G -A- G -A- G -A- G -A- G -A- G-Aol ... G -A- G -A- G -A- G -A- G -A- G-Aol G -A- G -A- G -A- G -A- G -A- G -A- G-Aol G -A- G -A- G -A- G -A- G -A- G -A- G -A- G-Aol G -A- G -A- G -A- G -A- G -A- G -A- G -A- G -A- G-Aol 509.1 815 .2 1 121 .3 1 427 .4 1733.5 20 39.6 23 45.7 26 51.8 655 .2 961.3 126 7.4 1573.5 ... carrageenans and agars containing 3,6-anhydrogalactose Anal Biochem 26 8, 21 3 22 2 Hama Y, Nakagawa H, Kurosawa M, Sumi T, Xia X & Yamaguchi K (1998) A gas chromatographic method for the sugar analysis of...
- 13
- 434
- 0
A Complete Handbook of Nature Cure ppt
... juice of any available seasonable fruit such as apple, pineapple, orange, sweet lime and grapes Breakfast :- Fresh fruits such as apple, orange, banana, grapes, or any available seasonal fruits, a ... Sit in padmasana Do 20 strokes of kapalbhati Inhale and exhale rapidly, making a puffing sound This is a good exercise for abdominal viscera and lungs Sheetali : Sit in padamasana or any other ... the lateral sides of the body Besides, it stimulates the adrenal glands and tones up the abdominal and pelvic organs 22 Pranayama Prana means ‘ vital force ‘ and Ayama means ‘ control ‘ in Sanskrit...
- 265
- 3,177
- 0
Báo cáo khoa học: and protein bilinear indices – novel bio-macromolecular descriptors for protein research: I. Predicting protein stability effects of a complete set of alanine substitutions in the Arc repressor ppt
... GA 52- st11 KA6-st 6a RA16-st6 VA25-st6 10 MA4-st6 11 Arc-st 6a 12 EA27-st6 13 KA2-st6 14 QA9-st6 15 GA3-st6 16 MA1-st 6a 17 Arc-st11 18 SA5-st6 19 RA13-st6 20 KA46-st11 21 EA17-st 6a 22 VA18-st6 23 ... NA11-st 6a QA39-st11 GA 52- st11 KA6-st 6a RA16-st6 VA25-st6 10 MA4-st6 11 Arc-st 6a 12 EA27-st6 13 KA2-st6 14 QA9-st6 15 GA3-st6 16 MA1-st 6a 17 Arc-st11 18 SA5-st6 19 RA13-st6 20 KA46-st11 21 EA17-st 6a ... 0.50 22 VA18-st6 0.50 23 RA23-st11 1 .20 24 KA24-st11 0.60 25 EA43-st6 0.30 26 EA28-st11 0.50 27 MA7-st6 0.60 28 DA20-st6 0.80 29 IA51-st11 1.90 30GA49-st11* 2. 00 31LA19-st6 1.90 32GA30-st11 2. 50 33RA50-st11...
- 29
- 406
- 0
báo cáo hóa học: " A preliminary study of clinical assessment of left unilateral spatial neglect using a head mounted display system (HMD) in rehabilitation engineering technology" pdf
... set as a cutoff value 3 -2 Special test with HMD (Figure 2) (a) Experimental apparatus The main experimental apparatus includes a digital camera, HMD (GT270, Canon Inc.), and a digital video camera ... finding an abnormal movement Data analysis All statistics were performed using SPSS statistical software (7.5 .2 J) An ANOVA or Student's t test was used as a comparison between the common clinical ... rehabilitation approaches Our system may have clinical implication for new assessment because HMD can change versatile visual input to fit each patient's degree of USN Because, a clinical assessment...
- 9
- 541
- 0
Báo cáo khoa học: "Proposing the lymphatic target volume for elective radiation therapy for pancreatic cancer: a pooled analysis of clinical evidence" ppsx
... local spread of T1 and T2 pancreatic cancer A study of autopsy material Ann Surg 1986, 20 4:65-71 25 Kayahara M, Nagakawa T, Futagami F, Kitagawa H, Ohta T, Miyazaki I: Lymphatic flow and neural ... head based on histopathologic analysis Int J Radiat Oncol Biol Phys 20 05, 62: 1 021 -1 029 17 Kayahara M, Nagakawa T, Ohta T, Kitagawa H, Ueno K, Tajima H, Elnemr A, Miwa K: Analysis of paraaortic ... invasion associated with carcinoma of the body and tail of the pancreas Cancer 1996, 78 :24 85 -24 91 26 Kayahara M, Nagakawa T, Kobayashi H, Mori K, Nakano T, Kadoya N, Ohta T, Ueno K, Miyazaki...
- 13
- 310
- 0
Báo cáo khoa học: " Differential protection by wildtype vs. organelle-specific Bcl-2 suggests a combined requirement of both the ER and mitochondria in ceramide-mediated caspase-independent programmed cell death" docx
... immunoblots, transient transfections, flow cytometric analyses and analyzed data JS carried out additional flow cytometry, morphological analysis by microscopy and analyzed data LT analyzed caspase activity ... proposed that excess formation of ROS triggers ciPCD by activation of the DNA repair enzyme PARP, followed by intracellular depletion of NAD+ and ATP, nuclear translocation of AIF and finally, death ... critical reagents and participated in the design of the study DA conceived and designed the experiments, analyzed data and wrote the paper All authors read and approved the final manuscript Acknowledgements...
- 9
- 388
- 0
Báo cáo y học: "Palpable pediatric thyroid abnormalities – diagnostic pitfalls necessitate a high index of clinical suspicion: a case report." docx
... cellular arrangement and an intranuclear pseudo-inclusion (arrow) Papanicolaou stain at 400× magnification b Final histology showed a papillary carcinoma, follicular variant There are characteristic ... 20 05, 23 5:604-613 Taki S, Terahata S, Yamashita R, Kinuya K, Nobata K, Kakuda K, Kodama Y, Yamamoto I: Thyroid calcifications: sonographic patterns and incidence of cancer Clin Imaging 20 04, 28 :368-371 ... Journal of Medical Case Reports 20 07, 1 :29 weight of 92 pounds Her exam was significant for a diffusely enlarged thyroid gland of approximately 45 grams with an irregular contour and a nodular...
- 5
- 264
- 0
Báo cáo khoa học: ":Bench-to-bedside review: A brief history of clinical acid–base" pps
... chemical) mechanisms to increase the plasma bicarbonate concentration [8] More than 20 years later, at the beginning of the polio epidemic, Danish physicians used the plasma bicarbonate Available ... dioxide and bicarbonate [ 12] Both base excess and bicarbonate ‘rules of thumb’ used a bicarbonate-centred approach [4,5,9] The great trans-Atlantic debate Siggaard-Andersen, from Copenhagen, developed ... correction factor [24 ] Disagreement between Americans and Danes over the usefulness of base excess led to the ‘Great Trans-Atlantic Acid–Base Debate’ [25 ] Instead of base excess the Americans offered...
- 6
- 280
- 0
Báo cáo y học: "Moxibustion and other acupuncture point stimulation methods to treat breech presentation: a systematic review of clinical trials" pptx
... 320 NA 28 Xiong 1991 [26 ] CCT 60 20 28 /20 28 32 36/ 32 36 Wu 1995 [23 ] CCT 820 20 –37 20 –37 Jiang 1993 [25 ] CCT 3 82 20–38 30–40 Qin 1989 [27 ] CCT 150 NA 30–37 Kanakura 20 01 [22 ] CCT 548 28 .4 28 ... data extraction and analysis, and quality assessment XYW and HRZ performed the manual searches, data extraction and quality assessment All authors read and approved the final version of the manuscript ... of a study Data analysis Review Manager Software 4 .2. 7 provided by the Cochrane Collaboration was used for data analysis Dichotomous data were expressed as a risk ratio (RR) with a provision of...
- 8
- 487
- 0
E-DTS 2.0: A NEXT-GENERATION OF A DISTRIBUTED TRACKING SYSTEM
... provide an accurate tracking estimate as to the current location of the object This camera communication is done over a local area network (LAN) and allows for the sharing and propagation of tracking ... robot 2. 1 Related Work in Camera Calibration In vision based tracking systems quality camera calibration is key Because of this, there are various techniques and methods available that provide camera ... camera calibration In most camera based calibration techniques and methods calibration takes place using physical measurement of the various points in 3D The calibration of the camera is based...
- 88
- 299
- 0
A concise review of clinical laboratory science 2010
... 198 20 0 20 1 20 2 20 2 20 2 20 3 20 5 20 7 20 8 21 7 21 9 22 1 22 4 22 5 22 8 23 0 23 1 23 3 23 4 23 5 23 6 Clinical Microbiology 23 8 Lynne Hamilton and Hal Larsen I Bacteria ... transaminase, alanine transaminase, creatine kinase, and γ -glutamyl transferase c Hydrolases catalyze the hydrolysis of ether and ester Examples are alkaline phosphatase, acid phosphatase, amylase, and ... layer of absorbent material is coated on a plate of glass, and spots of samples are applied The solvent is placed in a container and migrates up the thin layer by capillary action Separation is achieved...
- 434
- 2,971
- 0
Báo cáo toán học: "The number of 0-1-2 increasing trees as two different evaluations of the Tutte polynomial of a complete graph" potx
... Combinatorial Theory Ser A, 18, 141–148, 1975 [4] Foata, D.: Groupes de r´arrangements et nombres d’Euler C R Acad Sci Paris e Sr A- B, 27 5, A1 147 A1 150, 19 72 [5] Foata, D and Strehl, V.: Rearrangements ... Matroid Applications Cambridge University Press, Cambridge, 123 22 5, 19 92 the electronic journal of combinatorics 15 (20 08), #N28 [3] Donaghey, R.: Alternating permutations and binary increasing trees ... vertices of Kn are labelled 1, 2, , n For a spanning tree A of Kn , an inversion in A is a pair of vertices labelled i,j such that i > j and i is on the unique path from to j in A Let invA be...
- 5
- 319
- 0
báo cáo khoa học: "Sustained complete remission of human epidermal growth factor receptor 2-positive metastatic breast cancer in the liver during long-term trastuzumab (Herceptin) maintenance therapy in a woman: a case report" docx
... patient achieves long-lasting remission on maintenance trastuzumab therapy We also speculate that the specific localization of breast cancer metastases may be a factor given that many of the cases ... treatment of metastatic breast cancer Oncologist 20 04, 9:617-6 32 Slamon DJ, Clark GM, Wong SG, et al: Human breast cancer: correlation of relapse and survival with amplification of the HER -2/ neu ... to eight years, and in all cases, maintenance therapy was based on trastuzumab One of these cases also illustrates the risk of withdrawing trastuzumab treatment when the patient had experienced...
- 4
- 211
- 0
A MANAGER’S GUIDE TO THE DESIGN AND CONDUCT OF CLINICAL TRIALS - PART 2 pps
... the appropriate software for data entry, data management, and statistical analysis is normally divided among the lead software engineer, the data manager, and the statistician (subject, of course, ... beyond an understanding of the data management software to security (maintaining onsite and offsite backups) and quality control Programs for Data Analysis Development of programs for data analysis ... Chapter 12 Maintain a database and provide for its security See Chapter 11 Maintain a schedule of regular visits to the investigators (in parallel with K) See Chapter 13 Collate data (in parallel...
- 26
- 555
- 2
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25