exercise 1 matching the words in column a and their vietnamese meanings in

Use the words in capitals to form a word that fits into the space next to it

... (EMPLOY) 62 The new manager was very efficient and (BUSINESS) 63 It really isn't mine I think that you are (TAKE) 64 The rate of in Brazil has been rising steadily (EMPLOY) ... 26.We had to get special to leave early (PERMIT) 27.As the best man, he had to make a at the wedding (SPEAK 28 He was sitting in his seat on the train (COMFORT) ... With the real plan, the rate of in Brazil has fallen (INFLATE) 66 She looked at him , and started to cry (HAPPY) 67 The party was , everything went wrong (DISASTER)...

A study of the linguistic features of suggestion verbs in english and their vietnamese equivalents

Danh mục: Khoa học xã hội

... differences between the two languages 3.7 RELIABILITY AND VALIDITY Chapter FINDINGS AND DISCUSSIONS 4 .1 SYNTACTIC FEATURES OF ESVs AND THEIR VIETNAMESE EQUIVALENTS 4 .1. 1 Structures with ASK and Their Vietnamese ... with an 13 14 indicative verb In addition, it combines with the infinitive or toinfinitive in English Moreover, after DEMAND, a noun or noun phrase can be used As can be seen in their Vietnamese ... are analyzed basing on the theoretical background by Quirk et.al [33] such as the construction of the verbs, verb phrases The semantic characteristics are shown like the meaning nuances and the...

13
1,330
5

A study of verbs of matching in english and their vietnamese translational equivalents

Danh mục: Khoa học xã hội

... or similar or to be closely linked between Subject and Object Due to their semantic meanings, they could have Table 4.5 English Matching Verbs and Their Vietnamese MATCHING From the findings, we ... for teaching, learning, and translating EMVs 3.3 VALIDITY AND RELIABILITY background Collecting data: The relevant data are taken from 14 English CHAPTER novels, short stories and their Vietnamese ... equivalents theoretical background on the matching verbs and it related matters are based on the viewpoint of Biber D et al - Choosing the approach to the problem and the theoretical - Suggesting some...

A study into words, idioms denoting 'richness' and 'poorness' in enghish and their vietnamese equivalents

Danh mục: Khoa học xã hội

... categorical meaning They not share all the grammatical features Thus, all the lexemes sharing categorical meaning not have all the grammatical meanings 1. 3.2 Lexical meaning According to Hoang Tat ... discuss about the meaning of having a lot of money, as in: A free and prosperous Irag will be a major blow to the terrorists and their desire to establish a safe haven in Irag where they can plan an ... which carry the meaning, of which the words are the smallest units that can stand on their own and possess individual meanings Together with the importance of vocabulary in communication, language...

64
1,015
5

A study on the translation of technical terms in the interface of common business website and their Vietnamese equivalent

Danh mục: Khoa học xã hội

... (Domain Name Service / Server) Most abbreviations that are used world-wide still remain in Vietnamese even they were translated into Vietnamese In the above examples, “DNS” and “RSS” are abbreviated ... translation, literal translation, faithful translation, semantic translation, adaptation, free translation, idiomatic translation and communicative translation And basing on the degree of emphasis ... according to Bell, translation is The transformation of a text originally in one language into an equivalent text in a different language retaining, as far as possible, the content of the message...

USE THE CORRECT FORM OF THE WORDS IN BRACKETS pdf

Danh mục: Cao đẳng - Đại học

... (noise) 12 5 12 6 12 7 12 8 12 9 13 0 13 1 13 2 13 3 13 4 13 5 13 6 13 7 10 11 12 13 14 15 16 17 Some famous directors make their films very (really) Advertising makes people buy more (produce) He never takes ... interesting programmes (add) What has women’s movement resulted in? (liberate ) 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 10 0 10 1 10 2 10 3 10 4 10 5 10 6 10 7 10 8 10 9 11 0 11 1 11 2 11 3 11 4 ... very much A) Attraction B) Attractive C) Attractively D) Attracted I was ……… right when I said that the man was guilty A) reason B) reasonable C) unreasonable D) reasonably She is an ……… mother She’s...

6
2,590
21

Exercise 1: Choose the best answer for each sentence below. ppt

Danh mục: Anh ngữ phổ thông

... such a mistake again A make B to make C making D made 16 My father wanted me _ a pilot A become B becoming C to become D became 17 What makes you _ so? A B did C done D doing 18 Mr Thomas ... A inform B to inform C informing D informed He began _ English two years ago A learn B learnt C learning D learns 10 The machine needs _ A repair B to repair C repairing D repaired 11 ... gamble B to gamble C gambling D gambled 17 Try to avoid _ him angry A make B made C to make D making 18 Stop _ and start _ A argue / work B arguing / working C to argue / to work D argued...

10
2,543
9

A study on idiomatic expressions containing words denoting food and drink in English and their Vietnamese equivalents from Cultural Perspective

Danh mục: Thạc sĩ - Cao học

... differences between British and American English: for example, banana skin and banana peel (an embarrassing mistake made by someone in a public position) or a slice/share of the cake and a slice/share ... containing food and drink in English and Vietnamese It is undeniable that idioms in general and English and Vietnamese idioms containing food and drink in particular always attract great attention ... teaching and learning this popular kind of idioms in English and Vietnamese as a foreign language 3.5 Reliability and validity The data were selected from English, American and Vietnamese books and...

A study on some english negative structures and their vietnamese equivelents in gone with the wind

Danh mục: Anh văn thương mại

... 1. 2.3.3 Halliday and Hassan Halliday and Hassan (19 76) looked at the issue of negation and polarity They pointed out that polarity is normally expressed at the beginning of the verbal group A ... a normal auxiliary expressing grammatical function, but a modal auxiliary With a negative modal auxiliary, verb phrase falls into a situation that the negation belongs to main verb or auxiliary, ... is applied in the theory revision to come to the nature of negation in English and Vietnamese Data randomly collected are qualitatively and quantitatively analyzed on the basis of grammatical and...

A study on idiomatic expressions containing words denoting food and drink in English and their Vietnamese equivalents from Cultural Perspective

Danh mục: Tổng hợp

... English and Vietnamese idioms containing food and drink - Analyze the cultural features of English and Vietnamese hidden behind those idioms - Compare and find the differences and similarities between ... Theoretical significance: The study supplies Vietnamese teachers and learners with a deeper understanding of idioms in general and idioms containing food and drink in particular in term of their syntactic, ... idioms containing food and drink and their equivalents in Vietnamese which have attracted me most for a long time in view of their variety in English idiom treasure Research aims and research questions...

A STUDY IN THE SELECTIVE POLYMORPHISM OF a AND b GLYCINE IN PURE AND MIXED SOLVENT

Danh mục: Cao đẳng - Đại học

... rates at the ( 010 ) surface 11 8 Table 7-6: Values for calculating the growth rates at the ( 010 ) surface in mixed solvent 12 0 Table 7-7: Number of particles sampled in the bulk and at the ... multi-scale approach (Fig 1. 2) that combines ab initio quantum mechanical calculations with molecular dynamics and thermodynamic analysis In particular, we use the GAUSSIAN [13 ] software together with ... discovery and characterization are vital in determining the viability of both processes and products Certain crystal polymorphs are disliked in commercial crystals because they give the crystalline mass...

Sphingosine kinase 1 regulates the expression of proinflammatory cytokines and nitric oxide in activated microglia

Danh mục: Kỹ thuật - Công nghệ

... CTCACTGGGACAGCACAGAA 217 GGATGCCACAGGATTCCATAC CCA GGAAAGCAACCACGGGCACA 314 507 5’GCTTCGAGTCCTGACCCA 3’ 5’GGCCACTTGTCTCTCGAT 3’ 5’ACTGTTGGAGACAGACTGAA CG 3’ 5’ TGGAGACTTCTGCCCATT 3’ 5’CAGGTCCGACAAAGTGAG ... of the components of the outer membrane of gram negative bacteria and is an activator of microglia LPS has been shown to activate the microglia by crossing the blood-brain barrier (BBB) in areas ... Protease inhibitor cocktail kit (78 410 , HaltTM, IL, USA) Protein assay kit (500-0007, Bio-Rad, California, USA) Μouse anti β actin Abcam ab180 61, Cambridge, USA, Rabbit polyclonal SphK1 ABGENT AP7237c,...

Supply the correct form of the words in brackets

Danh mục: Chứng chỉ A, B, C

... consuming and costly 10 1 The Cotswold’s is an area of great ( beautiful) in England It has a number so( delight) villages and small towns with lovely building that have remained ( change) ... change) since the area was a major( commerce) center several centuries ago The countryside in the area is ( charm) and most of the buildings there ear made from an( attract) of ... 11 9 Some of these traditional dresses have been ( modern) 12 0 Many Vietnamese women continue to wear the unique and ( fashion) dresses 12 1 ( Embroidery) jeans are the 19 60s’fashion 12 2...

7
6,384
25

A study of conditional sentences in the novel jane eyre by charlotte bronte and their vietnamese equivalents

Danh mục: Kinh tế - Quản lý

... support the main data, the research was supported by other data taken from internet and grammar book about conditional sentences In order to attain the purpose, the data of the research was analyzed ... “Jane Eyre” by Charlotte Bronte The main data are conditional sentences in the novel To support the main data, the research is supported by other data taken from internet and grammar books about ... type as the automatic consequences, habit and truth In addition, A. V.Martinet, Betty Schrampfer Azar and John Eastwood talked about mix type such as 1- 3, 2-3, 3-2 In universal grammar, the linguisticians...

A study on syntactic and semantic features of the thinking verb group in english and their vietnamese equivalents

Danh mục: Kinh tế - Quản lý

... nghĩ and meaning in 1bnghĩ but in 1c and 1d the meaning in Vietnamese is cho and nghĩ 4 .1. 2.2 ASSUME and their Vietnamese equivalents Assume is a transitive verb, which may also be followed by a ... meaning In each context the meaning has it owns different meaning In 1a and 1bthink verb after modal verb able to/ can’t, verb is infinitive without “to” In a the meaning in Vietnamese meaning ... meaning In 4a, 4d the meaning in Vietnamese nhớ and meaning in 4b, ghi nhớ but in 4c and the meaning in Vietnamese is cho and nghĩ 4 .1. 2.5 KNOW and their Vietnamese equivalents Know is both transitive...

78
1,974
21

Truyện tiếng anh:【1】15 the wind in the willows

Danh mục: TOEFL - IELTS - TOEIC

...

A study of linguistic features of adjectival phrases denoting personality in english and their vietnamese equivalents

Danh mục: Khoa học xã hội

... t t [ 41, p 229] translate into Vietnamese The examples above are used to describe the grandfather, the b For Female father, the husband and the teacher who have good behavior, In the example ... defined as words, phrases and clauses that describe a noun and noun phrase [65] Table 4.2: APDP as predicate adjective and their Vietnamese Personality in English and Their Vietnamese Equivalents The ... nh a idle, and lawless, and vulgar, and bad in (82); bad in (83) and full of the old scratch (84) In the scene of (96) comes from the final confrontation between a woman and a man She says that...

Tài liệu Project (written version):“The problems of the “Citibus” (bus operating company) and their possible solutions. Drawing a contract.” doc

Danh mục: Quản lý dự án

... new roads and rearrange the traffic within the city in general); another highly probable reason is that the city administration doesn’t show the proper interest and enough initiative in solving ... this particular problem; 3) and the last but not the least problem is the problem of low organization and management within the “Citibus”company (the symptoms 5, 6, 7, 9, 10 ): into our opinion, ... other laws of Ukraine and to make this document has a legal effect) On the next stage both parties sign the contract and we think that the drivers are enough motivated, they fulfil the terms and...

Tài liệu Báo cáo khoa học: The small heat shock proteins and their role in human disease pptx

Danh mục: Báo cáo khoa học

... FEBS Journal 272 (2005) 2 613 –2627 ª 2005 FEBS Small heat shock proteins and disease 10 7 10 8 10 9 11 0 11 1 11 2 11 3 11 4 11 5 11 6 11 7 11 8 11 9 aB-crystallin in Alzheimer’s disease Acta Neuropathol (Berl) ... expression, thereby 2620 Mutation References aA-crystallin R 116 C aA-crystallin R49C aB-crystallin R120G aB-crystallin R120G aB-crystallin DC13 aB-crystallin DC25 aB-crystallin R120G Hsp25 S135F Hsp25 R127W ... from normal aged and cataractous lenses Biochim Biophys Acta 15 49, 17 9 18 7 Shridas P, Sharma Y & Balasubramanian D (20 01) Transglutaminase-mediated cross-linking of a- crystallin: structural and functional...

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25

exercise 1 matching the words in column a and their vietnamese meanings in column b