example of an architecture where the stored procedures can apos t be reused without also reusing the components in the business logic layer
Tài liệu Module 5: Managing the Business Logic Layer pptx
... group, the Predictor resource can be left to target the product that is most likely to be of interest to that shopper Both targeting methods offer a mechanism that increases the chances that the ... site to the individual member can improve the relationship between a user and the organization and can contribute to the sort of brand loyalty that is important on the Web The key to such adaptation ... of the user and analyzed the profiles, the final stage in the site management cycle is to implement the targeting This can either be explicit or implicit Types of Targeting Expression-based targeting...
- 60
- 420
- 0
Tài liệu Module 6: Transaction Processing on the Business Logic Layer docx
... each ItemIndex in objItems intHandleItems = intHandleItems + ItemIndex("quantity") Next intHandleCost = intHandleItems * m_intItemHandling If intHandleCost > m_intMaxHandling then intHandleCost = ... to indicate that the current transaction is to be terminated If no errors occur, the component instance can indicate its approval for the transactional system to attempt to commit the current ... 6: Transaction Processing on the Business Logic Layer 35 Exercise Inserting the Handling Object into the OPP In this exercise, you will insert the handling object into the relevant stage in the...
- 42
- 516
- 1
Introduction of An Introduction to the Philosophy of Mind
... chapters and 4, I move on to discuss certain general theories of the nature of mental states and some attempts to explain how mental states can have content – that is, how they can apparently be ... suppose that a reality independent of our beliefs exists at all To these sceptics I reply that the pursuit of metaphysics is inescapable for any rational being and that they themselves demonstrate this ... reasoning into practice by engaging in intentional action, with the aim of bringing about desired changes in things and states of affairs in the world Finally, in chapter 10, we try to understand...
- 7
- 532
- 0
Tài liệu Báo cáo khoa học: Characterization and mode of action of an exopolygalacturonase from the hyperthermophilic bacterium Thermotoga maritima doc
... peptide and the detection of pectinolytic activity in the cell fraction and not in the medium fraction supported our belief that PelB is cytoplasmic, in contrast with the majority of polygalacturonases ... seems to be in conict with its cytoplasmic character and may perhaps be due to conformational changes in the substrate, thereby facilitating binding to the substrate-binding cleft It is obvious that ... assumptions of Hiromi [30] that the intrinsic rate of hydrolysis (kint) in the productive complex is independent of the length of the substrate, Km and Vmax were used to calculate the subsite afnities...
- 10
- 592
- 0
Tài liệu Báo cáo khoa học: Coordination chemistry of iron(III)±porphyrin±antibody complexes In¯uence on the peroxidase activity of the axial coordination of an imidazole on the iron atom ppt
... pocket of the antibody than the binding of the second one, most probably because of the steric hindrance brought by the protein around the iron atom of the porphyrin Binding of monosubstituted ... than that for 1-methylimidazole, which could arise from a more important steric interaction of the 1-benzyl substituent with the antibody protein than that with the 1-methyl substituent In the ... with two objectives: ®rst, to get more precise information about the topology of the binding site of the antibody and particularly to appreciate the size of the cavity left around the iron atom and...
- 11
- 470
- 0
Báo cáo y học: Identification of an element within the promoter of human selenoprotein P responsive to transforming growth factor-b ppt
... binding of Smad proteins to two adjacent DNA elements in the plasminogen activator inhibitor-1 promoter mediates transforming growth factor beta-induced smad-dependent transcriptional activation ... addition of Smad-specific antibodies points towards the involvement of additional nuclear factors which ultimately mediate the transcriptional repression and conceal the antigenic determinants of ... extracts Fig Schematic representation of the SeP promoter constructs used in this study The numbering given refers to the major transcription start site of the human SeP gene [6] For simplicity,...
- 6
- 361
- 1
Báo cáo y học: "Effects of recombinant human growth hormone on HIV-1-specific T-cell responses, thymic output and proviral DNA in patients on HAART: 48-week follow-up" ppt
... significant differences observed between the medians at any of the time points, although an increase was seen in three of 12 patients (Table 1) These increases were not observed in patients in whom ... collected at baseline, weeks 12 and 24 of the study plus a follow up visit at week 48 from the start of the study The patients' informed consent and Ethics Committee approval were obtained for the ... indication of the extent of intrathymic proliferation [38], which determines the thymic output of naïve T cells [39] However, the analysis of ratios in these studies has confirmed that sjTREC...
- 13
- 359
- 0
Tài liệu An Example of Using the Get* Methods phần 1 pdf
... productsSqlDataReader.GetOrdinal("UnitsInStock"); int discontinuedColPos = productsSqlDataReader.GetOrdinal("Discontinued"); // use the GetFieldType() method of the DataReader object // to obtain the ... productsSqlDataReader.GetFieldType(productIDColPos)); This example displays: ProductID NET type = System.Int32 As you can see, the System.Int32 NET type is used to represent the ProductID column The System.Int32 NET ... NET type corresponds to the C# int type You can see this type correspondence in Table 9.3, shown earlier You can get the database type for a column using the GetDataTypeName() method of your DataReader...
- 6
- 594
- 0
Tài liệu An Example of Using the Get* Methods phần 2 docx
... GetSql* METHODS SQL SERVER TYPE Sql* TYPE GetSql* METHOD bigint SqlInt64 GetSqlInt64() int SqlInt32 GetSqlInt32() smallint SqlInt16 GetSqlInt16() tinyint SqlByte GetSqlByte() bit SqlBoolean GetSqlBoolean() ... GetSqlSingle() datetime SqlDateTime GetSqlDateTime() smalldatetime SqlDateTime GetSqlDateTime() char SqlString GetSqlString() varchar SqlString GetSqlString() text SqlString GetSqlString() nchar ... Methods Let's take a look at an example that reads the ProductID, ProductName, UnitPrice, UnitsInStock, and Discontinued columns from the Products table using the GetSql* methods To figure out...
- 6
- 471
- 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC ... constant, and more importantly the dissociation constant This result suggests that residue 101 in the CDR3 (Val101Phe) of the heavy chain might also be important for binding to the toxin The change ... but it still detaches rapidly, suggesting that Gly at position 54 might play an important role in the interaction of the antibody with the toxin Cn2 Variant 6F was not able to neutralize the toxin...
- 11
- 679
- 0
– THE GRE QUANTITATIVE SECTION – Example of solving an equation: 3x + 5 = 20 –5 = –5 3x = pot
... number written in the interior of the angle near the vertex: Є1 When more than one angle has the same vertex, three letters are used, with the vertex always being the middle letter: can be written ... is two times the length of the leg opposite the 30-degree angle.) The leg opposite the 60-degree angle is times the length of the other leg 188 – THE GRE QUANTITATIVE SECTION – 60 2s s 30 sΊෆ Example: ... IGHT T RIANGLES In a right triangle with the other angles measuring 30 and 60 degrees: ■ ■ The leg opposite the 30-degree angle is half the length of the hypotenuse (And, therefore, the hypotenuse...
- 25
- 340
- 0
báo cáo hóa học: " Development and validation of the Brazilian version of the Attitudes to Aging Questionnaire (AAQ): An example of merging classical psychometric theory and the Rasch measurement model" pptx
... significantly between the two samples and raises the question of whether these similarities remain or not in other different cultures The demonstration of cultural invariance of the core attitudes to ... -.195 Items in bold were retained in the international final version the International dataset too Out of these, only item 18 remained in the final international AAQ version The Multi-trait Analysis ... design, data collection, statistical analysis and drafted the manuscript; MPF participated in the study design, statistical analysis and helped to draft the manuscript; CMT participated in the study...
- 10
- 871
- 0
báo cáo hóa học:" Development and validation of the Brazilian version of the Attitudes to Aging Questionnaire (AAQ): An example of merging classical psychometric theory and the Rasch measurement model" docx
... significantly between the two samples and raises the question of whether these similarities remain or not in other different cultures The demonstration of cultural invariance of the core attitudes to ... -.195 Items in bold were retained in the international final version the International dataset too Out of these, only item 18 remained in the final international AAQ version The Multi-trait Analysis ... design, data collection, statistical analysis and drafted the manuscript; MPF participated in the study design, statistical analysis and helped to draft the manuscript; CMT participated in the study...
- 10
- 737
- 0
báo cáo khoa học: " Improving eye care for veterans with diabetes: An example of using the QUERI steps to move from evidence to implementation: QUERI Series" ppsx
... writing the manuscript BW participated in the conduct of the implementation project and writing the manuscript SV conducted the cost-utility project and participated in writing the manuscript RAH ... participated in the conduct of the quality gaps and implementation projects, data acquisition, and writing the manuscript CLG participated in the conduct of the implementation project and writing ... design and conduct of the implementation project and assisted in writing the manuscript CEF participated in the conduct of the implementation project, data acquisition, and writing the manuscript...
- 11
- 443
- 0
Báo cáo y học: "Is obesity a risk factor for low back pain? An example of using the evidence to answer a clinical question" ppsx
... example clinical data from the experimental literature may or may not indicate that there is a link between overweight and low back pain Results The literature search into obesity and joint pain revealed ... most up to date data source on medically related topics The next step is to determine keywords to place in the search engine From the answerable question(s) it can be appreciated that the initial ... data should anyone wish to examine the source As an example of an evidence summary see Table It is at this time that the clinician is ready for the final step of applying the evidence In our example...
- 6
- 402
- 0
an example of the rsa algorithm
... 15756920979851832104115596935784883366531595132734467524394087576977 file:///C|/Documents%20and%20Settings/mwood/Deskto aphy /An% 2 0Example% 2 0of% 2 0the% 20RSA%20Algorithm.htm (2 of 4)8/1/2006 1:53:25 AM An Example of RSA Encryption 78908490126915322842080949630792972471304422194243906590308142893930 ... 51941619318479919134924388152822038464729269446084915299958818598855 file:///C|/Documents%20and%20Settings/mwood/Deskto aphy /An% 2 0Example% 2 0of% 2 0the% 20RSA%20Algorithm.htm (3 of 4)8/1/2006 1:53:25 AM An Example of RSA Encryption 19514906630731177723813226751694588259363878610724302565980914901032 ... 123 (mod 3233) = 123 If you have a computer program (such as the "bc" utility that comes with Linux), you can compute 855^2753 mod 3233 directly, like this: 855^2753 mod 3233 = 50432888958416068734422899127394466631453878360035509315554967564501...
- 4
- 400
- 0
A study on an example of non-verbal interaction between the presenter and audience for English majored students at the School of Foreign Language
... with the interaction Aims of the Study The study is conducted with two aims: The study aims at finding out the non – verbal interaction between the presenter and the audience in presentation The ... have better information Furthermore, the skills in presentation are not merely interaction between the presenter and the audience, they can also be many other things, and all of them should be ... opportunity to play the roles of people in certain situations 11 Startling statement: A startling statement grabs the audience members’ attention by shocking them or making them think about something...
- 50
- 454
- 2
Structuring an advertising business in Vietnam (an example of FPT media - the corporation for financing and promoting technology)
... the use of each media outlet in a particular moment in time The difference between the two is that the rating point refers to the percentage to the entire universe while the target rating point ... the use of the rating point (rp) or the more accurate target rating point (trp) These two measures refer to the percentage of the universe of the existing base of audience members that can be reached ... what determines the shape of an organization’s hierarchy – that is, the number of levels of authority within an organization – and the span of control at each level? This question is important because...
- 104
- 1,457
- 2
Cambridge.University.Press.An.Introduction.to.the.Philosophy.of.Mind.Jan.2000.pdf
... discuss certain general theories of the nature of mental states and some attempts to explain how mental states can have content – that is, how they can apparently be ‘about’ things and states of affairs ... case: it doesn t seem correct to say that every part of the statue is a part of the lump of bronze Thus, for instance, if the statue is a statue of a man, then the statue’s arm will be one of its ... meaning thereby just that they feel, see, think, reason and so forth According to this view of the matter, the philosophy of mind is the philosophical study of minded things just insofar as they...
- 333
- 1,170
- 2
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25