... concentration of the drug in the samples was calculated as µg/ml of plasma The plasma concentration-time profile of levofloxacin after its concomitant administration with paracetamol in each animal was ... distribution and elimination pattern of levofloxacin on co-administration with paracetamol in the calves were calculated and are presented in Table The absolute dose of levofloxacin per day was calculated ... temperature, and kept at 20ºC until analysis, which was usually done on the day of collection The concentration of levofloxacin in the plasma samples was estimated by a standard microbiological assay...
... MG, Balasubramanian CK, Behrman AL, Kautz SA: Validation ofa speed-based classification system using quantitative measures of walking performance poststroke Neurorehabilitation and Neural Repair ... foot placement [24] All values of the temporal and spatial gait parameters reported are the mean values of to repeated gait trials along the walkway at the preferred speed Participants Gait pattern ... effects on cycling and walking ability in chronic stroke patients A case series study was designed and participants were recruited based ona gait pattern classification ofa population of 153 chronic...
... use ofa software package When data has been quantified, it can be used to compare and contrast other research and may be used to measure change Positivists believe that quantitative data can ... fifth of the totals cannot keep eye contact with their audience with 15% occasionally true and 5% never true These table show that a half of the totals are aware of the importance of having eye contact ... pp.19-26 Al-Issa, A (200 7a) English language teaching at the College of Law-Muscat, Sultanate of Oman: Analyzing needs and understanding problems Asian Journal of English Language Teaching, 17,...
... nhanh chóng có mặt thời gian tới Giới thiệu blueup IELTS Bộ sản phẩm flashcard blueup IELTS bao gồm 1100 từ vựng, chia thành 11 khác thuộc từ “Cambridge Vocabulary for IELTS” Pauline Cullen B a ... Cullen B a IELTS B a IELTS2 blueup hy vọng với blueup IELTS giúp bạn tạo tảng vững trước tham gia kỳ thi IELST blueup triển khai IELTS IELTS Mua flashcard blueup nào? Sản phẩm flashcard blueup thị ... TOEIC” Trong giai đoạn tháng 10 tháng 11 năm nay, blueup khởi động TOEIC B a TOEIC B a TOEIC2 Giới thiệu blueup TOEFL Bộ sản phẩm flashcard blueup TOEFL iBT bao gồm 1500 từ vựng, chia thành 15 khác...
... presented as the mean ± standard deviation for variables witha normal distribution, and as the median and interquartile range for variables with skewed distributions Parametric or nonparametric ... the acquisition of data NM helped to draft the manuscript, and participated in the acquisi- Page of 10 (page number not for citation purposes) tion of data AZ participated in the coordination of ... 12-bed medical ICU admits approximately 550 patients annually with an average age of 40 years Surgery patients, coronary patients, neonates and burn patients are treated in specialized units...
... design and a routine control selection design in a large case-control study that was incorporated into a nationwide mortality survey in China in 1989–1991 As an example, we assessed the hazards of ... than rural males, both study groups revealed a consistent pattern of the effect of smoking on risk of cancer deaths TABLE Characteristics of cases and two control groups: Population-based case-control ... have had consistent tobacco consumption since early adult life: this is particularly true in large rural areas Our findings also confirmed the fact that the conventional statistical significance...
... mechanism of hyperventilation seemed to appropriately describe laughter-associated-asthma The World Health Organization defined health as a “state of physical, mental and social well-being and ... an affective component, emotional well-being, is defined as the balance between pleasant affect and unpleasant affect (30) Life satisfaction included satisfaction of occupation, marriage and ... motor cortex and pyramidal tract to the ventral brain stem The involuntary path is comprised of amygdala, thalamic, hypothalamic, and subthalamic areas, in addition to the dorsal brain stem Moreover,...
... Contrast with formal group, with individual needs and demand, people gather creating informal group Within formal organization, it can appear a lot of informal groups Informal group relates ... develop with the experience Team work is useful because a lot of advantages: a combination of strengths, a range of opinion, divided responsibility, team spirit, administration and increase facility ... a leader, work as a team can distribute and specialize work, which produce advantages for every member.It also means that “manager can spend more time with each person ona smaller team as necessary”.4...
... your answers in the table below User Interface User Services Business Services Data Access Data Store Communication Operating Systems System Services Development Tools Data Access Data Storage ... responses with the class The instructor will write the class consensus ona flip chart Use the space below for brainstorming Activity 7.2: Determining the Impact of Technology ona Windows DNA ... Activity 7.2: Determining the Impact of Technology ona Windows DNA Design Exercise 1: Determining Technology Implications ! Determine technology implications Participate in small groups as assigned...
... of Hawai’i, Los Angeles, Miami, Newark, Providence, San Antonio, Savannah, and Seattle.32 Campaigns that Promote Savings and Financial Access The formation of AEIs and Bank On was happening at ... receiving paper checks Participants also must attend a financial education class and create a profile on the Bank On D.C online financial education portal Similarly, Bank On Jacksonville has reached ... and practices For example, a bank may contribute a certain amount to one program, but only offer a fraction of that amount to another program Additionally, some banks may not be comfortable with...
... ”technical” positions, including aviation machinist’s mate, aviation structural mechanic, aviation ordnanceman, aviation equipment support technician, and aviation survival equipmentman; and semi-technical” ... different ratings: ”highly technical” positions, such as air traffic controller, aviation electronics technician, aviation fire control technician, and aviation antisubmarine warfare technician; ”technical” ... up a large portion of the military, and would offset some of the advantages gained from a combined-specialty approach The key, therefore, would seem to be achieving a balance among additional...
... effectiveness of state laws, and lack of harmonization at the international level a number of states have started to block access to websites and social media platforms that allegedly contain illegal content ... participating States Albania, Armenia, Austria, Azerbaijan, Belarus, Bosnia and Herzegovina, Bulgaria, Canada, Croatia, Cyprus, Czech Republic, Denmark, Estonia, Finland, France, Georgia, Germany, Greece, ... harmonization of laws and approaches at the international level Regarding speech- and content-related laws and legal measures, any restriction must meet the strict criteria under international...
... between banks that have significant local market overlap ex ante may increase local market concentration and market share and allow the consolidated banks to raise profits by setting prices less favorable ... structure Alternatively, acquisition ofa relative small bank also has potential advantages, such as an easier integration of computer and accounting systems and fewer internal struggles for control ... substantial increases in market power by limiting the amount by which local market concentration can increase The data on the actual changes in local market concentration are consistent with...
... federation of 11 states in Peninsular Malaysia and the states of Sabah and Sarawak in the north of Kalimantan Kuala Lumpur, the national capital, Labuan UNEP/SCS – National Report Malaysia and ... tides of up to meters and witha tidal stream of over knots The West Coast of Peninsular Malaysia has an equatorial climate, with an average annual rainfall of more than 2500mm and a daily temperature ... Serdang, Malaysia vi UNEP/SCS – National Report Malaysia NATIONAL REPORT OF MALAYSIA ON THE BAY OF BENGAL LARGE MARINE ECOSYSTEM PROGRAMME By Ishak Haji Omar* INTRODUCTION 1.1 AIM OF REPORT The aim...
... Supplier Standards Product LCA Human Rights Standards International Standards Compliance National Standards Compliance EMS Environmental Data Availability Environmental Policy Grievance Process Labor ... corporations around the world The SAM Corporate Sustainability Assessment is based on the annual SAM Questionnaire, which consists of an in-depth analysis based on around 100 questions on economic, ... total assets at the end of 2009 Standard errors are robust to heteroscedasticity 49 Table Disclosure of Nonfinancial Information Panel A: Univariate Analysis of Nonfinancial Disclosure Nonfinancial...
... GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R OMCB-PBAD-F OMCB-PBAD-R 3736 controlled by an arabinose promoter ... OMCA-F OMCA-R OMCB-F OMCB-R OMCA-PBAD-F CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG ... reduction represents a potential strategy for the in situ immobilization and containment of contaminant metals and radionuclides in aqueous waste streams and subsurface environments, as some of these...
... financial statements into English 63 LIST OF ABBREVIATIONS Abbreviation Full Name AFA ASC ASEAN Federation of Accountants Accounting Standards Council ASEAN Association of South East Asian nations ... harmonization are the importance of accounting harmonization, the role of IASB, advantages and disadvantages of accounting harmonization, and different levels of accounting harmonization Chapter ... Federation of Accountants, the Asia-Oceania Tax Consultants' Association, and the International Federation of Accountants) Institute of Certified Accountants and Auditors of Thailand (ICAAT) is the...
... globalization 2.4 The impact of globalization on the financial performance of Vietnamese‟s company; a typical example is LCC‟s financial performance 2.1 A general look at financial statement Financial ... literature will be reviewed on the general look at financial statement, the general approach applied in analysis of financial statements, the nature of globalization, and the impact of globalization ... inequality across and within nations, volatility in financial market and environmental deteriorations Another negative aspect of globalisation is that a great majority of developing countries remain...