eu investment agreements comparable with us investment agreements in their scope of application and quality can only be concluded as mixed agreements thus a further transfer of competences from the member states to the eu seems necessary t
International Humanitarian Law and Human Rights Law Towards a New Merger in International Law
... merged in the contemporary corpus of IHL.38 The scope of the law of war was related to the other main branch of international law, the law of peace At the beginning of the 20th century, the generally ... provide the reasons why this idea was introduced at international level The main justication resides in the theoretical and practical distinction made in international law between IHL and HRL.16 The ... in international human rights instruments has aected the interpretation, and eventually the status, of the parallel norms in instruments of international humanitarian law.55 Despite this tendency,...
- 609
- 1,039
- 0
The Role of Genetically Modified Organisms (GMOs) in Beverage Production
... Examples of GM crops include insectresistant (Bt) corn, cotton, potato, and tomato; herbicide-tolerant soybeans, corn, rice, sugar beet, ßax, and canola; and virus-resistant squash, papaya, and potato ... recombinant bovine somatotropin IDENTITY PRESERVATION AND THE INTERNATIONAL MARKET In the past, it was not necessary for the food supply chain to segregate and identity preserve grain destined ... and to insert the capability of producing plant-based omega-3 fatty acids into oil seeds Biotechnology can be used to elevate levels of vitamins A, C, and D and folate; increase antioxidants; and...
- 6
- 498
- 0
Tài liệu Báo cáo khoa học: The central role of CDE/CHR promoter elements in the regulation of cell cycle-dependent gene transcription pdf
... These activating E2Fs cooperate with NF-Y proteins binding to CCAAT-boxes and with Myb proteins associating with a distal Myb site in activating the Cdc2 promoter Binding of the activating E2Fs ... [41] The CDE mutation that was assayed would also alter a putative CDE site with the standard distance of four nucleotides to the CHR With the data presented it is not quite clear where exactly the ... complex of inhibitory proteins at the CDE ⁄ CHR It was shown that E2F4 binds to the CDE and that Lin-54 binds to the CHR in the Cdc2 promoter in G0 It is probable that these proteins constitute part...
- 17
- 876
- 0
Tài liệu Báo cáo Y học: Steady-state kinetics of the glutaminase reaction of CTP synthase from Lactococcus lactis The role of the allosteric activator GTP in coupling between glutamine hydrolysis and CTP synthesis potx
... activation of the glutaminase activity by GTP was similar to that of the overall CTP synthesis reaction It was concluded that the effect of GTP was mainly to enhance the rate of chemical steps of ... UTP intermediate in a mechanism as that of Scheme 1A From Fig and Table it can be seen that the effect of saturating the active site with ATP-cS and UTP was a relief of partial inhibition by GTP ... research, we have analyzed the steady state kinetics of the glutaminase reaction of CTP synthase from L lactis in order to distinguish between the effects of GTP on the glutaminase reaction and the...
- 8
- 698
- 0
Báo cáo khoa học: The role of evolutionarily conserved hydrophobic contacts in the quaternary structure stability of Escherichia coli serine hydroxymethyltransferase pptx
... mutant was obtained introducing the L27 6A mutation into a template pS::glyA plasmid that already contained the L8 5A mutation E coli DH 5a cells were used to amplify the mutated plasmids Both strands ... PLP binding properties The affinity of wild-type and mutant forms for the cofactor was measured to evaluate the impact of the mutations on the structure of the PLP binding site Because PLP binding ... association of the a- helices that form the cluster and, consequently, to weaken their interaction with the N-terminal a- helix This can be imagined to be the main cause of subunit dissociation in apo-eSHMT...
- 12
- 578
- 0
Báo cáo khoa học: Use of lithium and SB-415286 to explore the role of glycogen synthase kinase-3 in the regulation of glucose transport and glycogen synthase pdf
... kinase pathway The notion that Li activates this stress signalling pathway is not unprecedented Li has been shown to acutely activate p38 MAP kinase in a human intestinal epithelial cell line, HT-29, ... immunoprecipitated for analysis of kinase activity GSK3 activity was expressed as a re-activation ratio (i.e GSK3 activity measured without PP 2A1 treatment divided by GSK3 activity after PP 2A1 treatment) ... confirmed that this was the case in muscle and fat cells (Fig 2) The adipocyte data suggests that despite the substantial reduction in GSK3 activity and expression that occurs during differentiation of...
- 10
- 804
- 0
Báo cáo Y học: Elucidation of the role of fructose 2,6-bisphosphate in the regulation of glucose fluxes in mice usingin vivo 13 C NMR measurements of hepatic carbohydrate metabolism docx
... for the infusion of glucose A third catheter was placed intraperitoneally as an alternative means of glucose administration should the tail vein fail, which was the case in only three animals, the ... likely that the increased rate of 13C label incorporation into the C6 position of glycogen in the ADM group is indicative of activated 6-phosphofructo-1-kinase, which can lead to increased 13C labeling ... suggests that the activation of 6-phosphofructo-1-kinase by this biofactor is more potent than its inhibition of fructose-1,6bisphosphatase This is a significant observation because it offers the...
- 9
- 465
- 0
Báo cáo Y học: The role of hydrophobic active-site residues in substrate specificity and acyl transfer activity of penicillin acylase pdf
... The bF24rv mutagenic primer was 5¢-ATAAGTATACGCAG GCGCATACCAGCCAAACTGCGGGCCATTTAC-3¢ and the bF57rv mutagenic primer was 5¢-GGAAATC ACACCATTATGACCAAAAACCAGCCCGGGATA GGC-3¢ The underlined codons ... indicates that the mutations in uence the rate of acylation by PGA in a similar way as the acylation by NIPAB A notable exception was the twofold increased activity for PGA of the aF146Y mutant It ... 0.03 that the binding of both the substrate NIPAB and the product PAA are significantly altered by mutating the phenylalanines in the active site suggesting that hydrophobic interactions between the...
- 8
- 561
- 0
The role of floating-rate bank loans in institutional portfolios pdf
... to worst for the other asset classes listed on the chart Indexes are unmanaged and cannot be invested in directly Data is historical and is not indicative of future results Russell Investments ... are subject to change at any time based upon market or other conditions and are current as of the date at the beginning of the document The opinions expressed in this material are not necessarily ... loans offer low correlations with other fixed income asset classes, but that as diversifiers they are not as strong as the Barclays Capital U.S Aggregate Bond Index relative to equity-linked asset...
- 9
- 333
- 0
Perceptions About Network Security: Survey of IT & IT security practitioners in the U.S. pptx
... important because it can provide insights from those who are dealing daily with the prevention and detection of these attacks Specifically, what they think about the current threat landscape and ... that the cost of cyber attacks is increasing Reducing an organization’s vulnerability to such attacks through the combination of proper staffing, enabling technologies and training programs can ... intelligence Twenty-three percent say their network security strategy is to baseline their approach against best practices and 14 percent say it is IT governance Bar Chart 17 What one statement best describes...
- 25
- 349
- 0
FUTURE OF THE NUCLEAR SECURITY ENVIRONMENT IN 2015 pptx
... for the project: one HEU storage facility at Argonne National Laboratory and one HEU storage facility at the Gas Plant at the Kurchatov Institute The Sandia/Argonne/Kurchatov Institute remote ... terrorists as well as the origin of any device actually detonated Both Russia and the United States make it clear that if a state assists terrorists in obtaining a nuclear weapon or the materials to ... work to install modern MPC &A systems at the Kurchatov Institute’s installations The first general cooperation agreements with the Los Alamos and Sandia National Laboratories in the United States...
- 324
- 504
- 0
Báo cáo khoa học: The role of Ureaplasma nucleoside monophosphate kinases in the synthesis of nucleoside triphosphates potx
... may be able to substitute the NDK activity [12,13] So far, no NDK activity was detected in total cell extracts or the chromatographic fraction of Mycoplasma pneumoniae in an attempt to isolate ... DNA as template and cloned into the pET14b vector using the Nde I and BamH I restriction sites A 6-His tag and a thrombin cleavage site were introduced to the N-terminus of the recombinant proteins ... CDP as the substrate and [c-32P]ATP as the phosphate donor, no radiolabelled dCTP formation was detected in the reaction with dCDP as the substrate, but it was observed when using CDP as the...
- 8
- 349
- 0
Báo cáo khoa học: Role of peroxidase inhibition by insulin in the bovine thyroid cell proliferation mechanism pdf
... control activity of TPO was determined in the presence of inactivated alkaline phosphatase Action of a- mannosidase on the inhibitor The inhibitor purified as described above, was evaporated to ... was added to the wells for h at °C After the removal of TCA the treatment was repeated The TCAprecipitable material was dissolved using 0.3 M NaOH, overnight at 37 °C and the radioactivity was ... scraped at the position where the brown spots had appeared on the first plate This material was then resuspended in water and extracted by shaking After centrifugation, the supernatant was assayed...
- 8
- 440
- 0
báo cáo hóa học: " The role of cumulative physical work load in symptomatic knee osteoarthritis – a case-control study in Germany" potx
... asked to identify all male patients between 25 and 70 years with knee osteoarthritis associated with chronic complaints Recruiting physicians had to state the date of initial radiographic diagnosis ... regarded as exploratory rather than hypothesis testing The power of the study is too small to obtain interpretable results for rare occupations as floor layers In the occupational group analysis, ... participated in the study design and and helped to draft the manuscript, NA participated in the design of the study and performed the re-assessment of all X-rays, GE coordinated the study and helped to...
- 8
- 518
- 0
báo cáo khoa học: "The role of 18F-FDG-PET/CT in the preoperative staging and posttherapy follow up of gastriccancer:Comparison with spiral CT" docx
... clinically evident metastasis was seen in the clinical follow up or increase in size was detected in the following control CT examinations In the evaluation of the skeletal metastasis, the rate ... of the study and drafted the manuscript MA and CS performed the statistical analysis, documentation of the data, literature analysis and participated in drafting the manuscript OK conceived of ... accepted because it cannot give the exact T stage and N stage of the disease, but in our study hybrid PET/CT was confirmed to be as successful as spiral CT in N staging, although T staging was of course...
- 5
- 390
- 0
Báo cáo y học: "The role of T cell interleukin-17 in conducting destructive arthritis: lessons from animal models" pps
... not a patient will respond to anti-TNF and anti-IL-1 therapy AntiIL-17 cytokine therapy might be an interesting new antirheumatic approach that could contribute to the prevention of joint destruction ... the existence of an IL-23/IL-17 axis of communication between the innate and adaptive parts of the immune system that might be an interesting target for the immunotherapy of inflammatory autoimmune ... destructive arthritis Because it is known that this T cell factor can have synergistic effects with catabolic/inflammatory mediators, it is tempting to speculate that IL-17 levels can influence whether...
- 9
- 294
- 0
Báo cáo y học: "The role of tumor necrosis factor-alpha in systemic lupus erythematosus" pdf
... in autoantibodies to histones and/ or chromatin in all seven patients, including those without anti-dsDNA antibodies [62] At least in part, the increase in anti-histone and anti-chromatin antibodies ... nephritis These data indicate that short-term TNF blockade in combination with azathioprine may be a step forward in the therapy of patients with lupus nephritis However, substantial evidence can be ... suggest that this increase is associated with (renal) disease activity as estimated by histology [51] In addition, TNF expression was demonstrated in refractory subacute cutaneous lupus erythematosus...
- 8
- 464
- 0
Báo cáo y học: "Role of hypoxia-inducible factor 1alpha in the integrity of articular cartilage in murine knee joints" potx
... contributions KG carried out the study design, the acquisition of data, the analysis and interpretation of data and drafted the manuscript DP participated in the study design and drafted the manuscript ... signal-regulated kinase/mitogen-activated protein kinase pathway [8-10] In osteoarthritic cartilage, the protein levels of HIF-1 are significantly increased and its activity correlates to the ... pathways and may also trigger proapoptotic events In view of the data of the present study and the data from the literature, HIF-1α may be considered an important element in balancing anabolism and...
- 12
- 393
- 0
Báo cáo y học: " Role of taurine on acid secretion in the rat stomach" ppsx
... suggesting that both the release of intracellular Ca 2+ from the ER as well as Ca 2+ influx into the cell are involved in CaSR-mediated H + /K + -ATPase activation [48] Thus, verapamil to block Ca ... light of the findings of previous investigations together with our observations of CSAD- and taurine-positive cells in the stomach and taurine released from CSAD- and taurine-containing neurons, ... that the stomach was free of solid contents A rat was decapitated, and its stomach was immediately removed The entire everted organ was then placed in a 20-ml organ bath containing a mucosal saline...
- 10
- 490
- 1
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25