establish a big tent culture of quality

báo cáo khoa học:" Reliability and validity of a single item measure of quality of life scale for adult patients with cystic fibrosis" pot

... scale measure and body image may suggest that adult patients with CF may have adopted a level of negative image (stigma) of the disease in manner that is different from an adaptation to physical ... Data analysis Descriptive statistics such as percentages, means, medians, standard deviations and range were used where appropriate The repeatability of the single-item quality of life scale and ... life score was a reasonably accurate predictor of health related quality of life There is no ‘gold standard’ outcome measure for assessment of quality of life in adult cystic fibrosis patients However,...

8
206
0

Tài liệu Báo cáo khoa học: Properties of ecdysteroid receptors from diverse insect species in a heterologous cell culture system – a basis for screening novel insecticidal candidates docx

Danh mục: Báo cáo khoa học

... on the aromatic moiety of dibenzoylhydrazines on larvicidal activity against the Colorado potato beetle Leptinotarsa decemlineata Pest Manag Sci 57, 858–865 Nakagawa Y, Minakuchi C, Takahashi K ... the absence of hormone (assigned a value of 1.0), to allow for direct comparison of quantitative transcriptional activity All data points are based on n = 3; error bars indicate one standard ... Ogura T, Minakuchi C, Nakagawa Y, Smagghe G & Miyagawa H (2005) Molecular cloning, expression analysis and functional conﬁrmation of ecdysone receptor and ultraspiracle from the Colorado potato...

12
627
0

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-speciﬁc blood vascular and lymphatic endothelial cells of the mouse pdf

Danh mục: Báo cáo khoa học

... the tsA58T Ag cDNA carrying the A4 38V mutation were PCR-ampliﬁed from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ ... Dong QG, Bernasconi S, Lostaglio S, De Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from ... Enzymatic digestion of organs Culture at 33 °C day tsA58T Ag-expressing endothelial cell Serial passages every 2–3 days at split ratio : day 20–30 Fig An endothelial cell culture scheme based...

11
873
0

The Impact of a Corporate Culture of Sustainability on Corporate Behavior and Performance pptx

Danh mục: Tài chính doanh nghiệp

... Supplier Standards Product LCA Human Rights Standards International Standards Compliance National Standards Compliance EMS Environmental Data Availability Environmental Policy Grievance Process Labor ... discussing alternative explanations A potential alternative explanation is that adoption of environmental and social policies is a luxury good that firms can afford when they are performing well, and as ... relevant data and constructs the Dow Jones Sustainability Index Once a year, SAM initiates and leads an independent sustainability assessment of approximately 2,250 of the largest corporations around...

57
447
0

Báo cáo khoa học: Observation of a chaotic multioscillatory metabolic attractor by real-time monitoring of a yeast continuous culture doc

Danh mục: Báo cáo khoa học

... treat each variable as a separate time series due to the lack of suitable methods for analyzing the dynamical properties of multidimensional data sets We would encourage our mathematical colleagues ... relative phases of the two waves Fast oscillations There is at least one fast oscillatory component with a period of $ which, like the circahoralian rhythm, appears, disappears and reappears at ... superposition of the cellcycle-dependent and circahoralian oscillatory modes rather than to variability in the underlying circahoralian clock Indeed, the IBIs of a superposition of sine waves also vary according...

8
242
0

the influence of corporate culture of vietnamese companies a study of corporation fpt

Danh mục: Sư phạm

... of each is also part of national culture In the growing process of corporate, national culture always has impacted (direct or indirect) on many different aspects of the culture of the corporate ... they are visible artifacts and observable behaviors – mission statement, architecture, narratives, language, ceremonies, and norms of behavior and symbols that are shared All of them are tangible ... Paris (France), and this is the first FPT’s office in Europe On 9th July, FPT Software announced the establishment of FPT Software Company Ltd in Kuala Lumpur- Malaysia (FPT Software Malaysia...

77
1,358
14

university of california press a culture of conspiracy apocalyptic visions in contemporary america nov 2003

Danh mục: Cao đẳng - Đại học

... organized by Richard H Popkin at the William Andrews Clark Memorial Library at UCLA in 1998 The examination of “inner earth” ideas in chapter was facilitated by an invitation from Mary N MacDonald ... California, Santa Barbara, Library; the Millennium Archive at the Van Pelt Library of the University of Pennsylvania; the Anti-Defamation League; and the Library of Congress I had the opportunity of presenting ... of California Library of Congress Cataloging-in-Publication Data Barkun, Michael A culture of conspiracy : apocalyptic visions in contemporary America / Michael Barkun p cm — (Comparative studies...

257
640
0

busby - 1825 - a treatise on the culture of the vine and the art of making wine

Danh mục: Hóa học - Dầu khí

...

303
403
0

báo cáo hóa học: " Improvement of quality of life, anxiety and depression after surgery in patients with stress urinary incontinence: Results of a longitudinal short-term follow-up" docx

Danh mục: Hóa học - Dầu khí

... scales and the FACT-G scales are concordant since decreased social withdrawal and avoidance, reduced psychosocial impact and less embarrassment are accompanied by better emotional and functional ... were, that they had to plan every detail in advance because of their UI and that they were afraid of physical activities, because of the association between involuntary loss of urine and physical ... sizes partial Eta squared (p2) were calculated Partial Eta squared specifies what proportion of the sum of error variance and a certain effect variance is explained by this effect in the sample:...

11
456
0

Báo cáo hóa học: " Predictors of quality of life: A quantitative investigation of the stress-coping model in children with asthma" pptx

Danh mục: Điện - Điện tử

... Garcia-Marcos L, Carvajal Uruena I, Escribano Montaner A, fernadez Benitez M, de la Garcia Rubia S, Tauler Toro E, Perez Fernandez V, Barcina Sancez C: Seasons and other factors affecting the quality ... Modelling covariances and latent variables using EQS London: Chapman & Hall; 1993 Mac Callum RC, Browne MW, Sugawara HM: Power analysis and detemination of sample size for covariance structure ... decides what can be done to deal with the situation (secondary appraisal) An event is appraised as stressful when primary appraisals exceed secondary appraisals, and by using coping processes a person...

9
336
0

Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot

Danh mục: Điện - Điện tử

... presence of TULV S RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855) To monitor the presence of ... Gilljam M, Kanerva M, Manni T, Pejcoch M, Niemimaa J, Kaikusalo A, Henttonen H, Vaheri A, Plyusnin A: Isolation and characterization of Tula virus: a distinct serotype in genus Hantavirus, family ... G-C U:G U -A C U C-G U -A GGAAAUG GCCAAGU 337 381 http://www.virologyj.com/content/2/1/12 (-) sense G C A A-U U -A U -A C C A- U C-G A- U U -A C-G A C A- U G A G-C A- U CCUUUAC CGGUUCA Figure structures...

5
483
0

báo cáo hóa học: " A refined in vitro model to study inflammatory responses in organotypic membrane culture of postnatal rat hippocampal slices" potx

Danh mục: Hóa học - Dầu khí

... performed data analysis and drafted the manuscript TS aided in slice culture experiments, participated in study design and gave critical analysis of the manuscript RM aided in manuscript preparation, ... Ewen MacDonald for checking the language of the manuscript and Mr Pasi Miettinen and Mrs Airi Boman for technical assistance This study was financially supported by the Academy of Finland and University ... Matsuda S, Sudo S, Fujita H, Sakanaka M, Maeda N: Induction of resting microglia in culture medium devoid of glycine and serine Glia 1998, 24:198-215 Nakamura Y, Si QS, Kataoka K: Lipopolysaccharide-induced...

15
345
0

báo cáo hóa học:" Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" ppt

Danh mục: Hóa học - Dầu khí

... presence of TULV S RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855) To monitor the presence of ... Gilljam M, Kanerva M, Manni T, Pejcoch M, Niemimaa J, Kaikusalo A, Henttonen H, Vaheri A, Plyusnin A: Isolation and characterization of Tula virus: a distinct serotype in genus Hantavirus, family ... G-C U:G U -A C U C-G U -A GGAAAUG GCCAAGU 337 381 http://www.virologyj.com/content/2/1/12 (-) sense G C A A-U U -A U -A C C A- U C-G A- U U -A C-G A C A- U G A G-C A- U CCUUUAC CGGUUCA Figure structures...

5
430
0

báo cáo hóa học:" Engagement of patients in religious and spiritual practices: Confirmatory results with the SpREUK-P 1.1 questionnaire as a tool of quality of life research" ppt

Danh mục: Hóa học - Dầu khí

... P sub-scales, such as age, sex, marital status, educational level, religious affiliation, SpR attitude, disease and duration of disease Using the method of univariate analyses of variance we ... sub-scale ExP had an alpha of 0.7797, sub-scale USP with its items had an alpha of 0.7535, and the sub-scale HuP with its items had a Cronbach's alpha of 0.7907, while the 3-item sub-scale NoP had ... aware of the way I treat the world around me"; item difficulty = 0.81), all values are in the acceptable range from 0.2 to 0.8 Factor analysis Factor analysis revealed a Kaiser-Mayer-Olkin value of...

11
425
0

báo cáo hóa học:" A cross-sectional study of health-related quality of life deficits in individuals with comorbid diabetes and cancer" potx

Danh mục: Hóa học - Dầu khí

... funding from the Canadian Diabetes Association and the Alberta Heritage Foundation for Medical Research JAJ is a Health Scholar with AHFMR and holds a Canada Research Chair in Diabetes Health Outcomes ... both diabetes and cancer, all of which would differentially impact the HRQL of individuals [26] Although type of cancer and a variable that allows calculation of time since cancer diagnosis are ... Health Canada: Responding to the challenge of diabetes in Canada First report of the National Diabetes Surveillance System (NDSS) Ottawa, Health Canada 2003 The Diabetes Control and Complications...

9
412
0

báo cáo hóa học:" The psychological context of quality of life: a psychometric analysis of a novel idiographic measure of bladder cancer patients’ personal goals and concerns prior to surgery" pot

Danh mục: Hóa học - Dầu khí

... positive and negative changes in quality of life ratings as well as apparent stability of ratings are each related to several distinct patterns of change in quality of life appraisal, even after controlling ... participation and affiliation, disease and treatment history, and co-morbidities Analysis Plan Our analysis included examination of patient characteristics and quality of life, thematic content ... content coding of responses to the Brief Quality of Life Appraisal Profile, examination of the relationship of goal attainment to goal content codes, and association of goal based measures with...

18
580
0

báo cáo hóa học: " The laval questionnaire: a new instrument to measure quality of life in morbid obesity" docx

Danh mục: Hóa học - Dầu khí

... of the MCID varied across domains and was in the range of 0.6 to 2.0 (always on a 7-point scale) Discussion This validation study indicated that the Laval Questionnaire represents a valid measure ... questionnaire to be used in clinical trials Methods The Laval Questionnaire The Laval Questionnaire is a 44-item questionnaire that is meant to be used as an evaluative instrument - that is, as a clinical ... the most important measurement property of a quality -of- life questionnaire used in clinical trials is its ability to reveal a minimal clinically significant change in a particular context This...

8
460
0

báo cáo hóa học:" The relationship of oral health literacy with oral health-related quality of life in a multi-racial sample of low-income female caregivers" doc

Danh mục: Hóa học - Dầu khí

... Suominen-Taipale AL, Lahti S, Nuttall NM, Allen PF: A cross-national comparison of income gradients in oral health quality of life in four welfare states: application of the Korpi and Palme typology ... income arguably remain the strongest correlates of oral health and disease, and literacy is one of numerous other distal determinants, OHL may be part of causal mechanisms that lead to worse oral ... Individuals’ perception of oral health and its impact on the health-related quality of life J Oral Rehabil 2007, 34:79-87 Allen PF: Assessment of oral health related quality of life Health Qual Life Outcomes...

9
364
0

báo cáo hóa học:" A systematic review of quality of life instruments in long-term breast cancer survivors" docx

Danh mục: Hóa học - Dầu khí

... adjustment of survivors of early-stage breast carcinoma, 20 years after adjuvant chemotherapy Cancer 2003, 98:679-689 35 Sammarco A: Quality of life among older survivors of breast cancer Cancer Nurs ... European Organization for Research and Treatment of Cancer-Breast Module; FACT-B = Functional Assessment of Cancer Therapy-Breast; FACT-G = Functional Assessment of Cancer Therapy-General; FACIT-SP ... disturbance, constipation, diarrhoea Global CARES-SF; Physical; Psychosocial; Medical interaction; Marital relationship; Sexual concerns Strength and health; Social barriers; Appearance and sexuality...

39
342
0

báo cáo hóa học:" Gender associated differences in determinants of quality of life in patients with COPD: a case series study" pdf

Danh mục: Hóa học - Dầu khí

... of hiperinflation and comorbidities explain almost 90% of the variation of the SGRQ total score in our male patients, dyspnea and level of arterial oxygenation only explained 50% of the variation ... represent an important message because most of the patients seen at pulmonary clinics have similar characteristics as ours Table summarizes the associated predictors of SGRQ total scores for males and ... Garc a- Aymerich J, Alonso J, Felez M, Khalaf A, Marrades RM, Monso E, Serra-Batlles J, Anto JM: Health-related quality of life and mortality in male patients with chronic obstructive pulmonary disease Am J...

7
358
0