epidemiological interaction at the wildlife livestock human interface can we anticipate emerging infectious diseases in their hotspots a framework for understanding emerging diseases processes in their hot spots
Báo cáo khoa học: " A rapid and efficient method for studies of virus interaction at the host cell surface using enteroviruses and real-time PCR" potx
... binding assay SI participated in handling and analysing recombinant cell lines AML was involved in the study design, draft and revision of manuscript All authors have read and approved the final ... obtained did not distinguish between binding to CHO and CHO-CAR using the clinical isolate of CVB5, although an indication of attachment to CHO-CAR was observed when measuring interactions at the ... temperature demonstrating that incubation at a higher temperature reduced unspecific attachment of this virus to CHO cells, while attachment to CHO-CAR, CHO-DAF and HeLa remained at the same level...
- 6
- 230
- 0
Tài liệu Báo cáo khoa học: Critical roles of Asp40 at the haem proximal side of haem-regulated phosphodiesterase from Escherichia coli in redox potential, auto-oxidation and catalytic control doc
... following oligonucleotides: Asp40Ala: 5¢-TGTTAATTAACGAAAATGCTGAAGTGATGTTTT TC-3¢ (forward); 3¢-GAAAAACATCACTTCAGCATTT CGTTAATTAAC-5¢ (reverse); Asp40Asn: 5¢-GGTGTT AATTAACGAAAATAACGAAGTGATGTTTTTCA ... AATTAACGAAAATAACGAAGTGATGTTTTTCA AC-3¢ (forward); 3¢-GTTGAAAAACATCACTTCGTTA TTTTCGTTAATTAACA-5¢ (reverse) Mutation sites are shown in italics Oligonucleotides were synthesized by the Nihon Gene Research Laboratory (Sendai, ... first-order rate constants for cyanide binding to Asp40 mutants were dependent on the cyanide concentration The rates of cyanide association to the Asp40Ala and Asp40Asn mutants were 0.065 and 0.073...
- 6
- 423
- 0
Báo cáo y học: "Association of the diplotype configuration at the N-acetyltransferase 2 gene with adverse events with co-trimoxazole in Japanese patients with systemic lupus erythematosus" pps
... Taniguchi A, Urano W, Nakajima H, Matsuda Y, Kitamura Y, Saito M, Yamanaka H, Saito T, Kamatani N: Adverse effects of sulfasalazine in patients with rheumatoid arthritis are associated with diplotype ... catabolized by NAT2, were also reported to be associated Figure Levels of serum ALT in fast acetylators and slow acetylators There acetylators were 47 fast acetylators and seven slow acetylators ... for NAT2* 6A, and G85 7A for NAT2*7B All of these substitutions cause amino acid changes It is curious, however, that the severe adverse events caused by sulfasalazine, associated with NAT2 variations,...
- 7
- 433
- 0
Báo cáo y học: "Advances in understanding the regulation of apoptosis and mitosis by peroxisome-proliferator activated receptors in pre-clinical models: relevance for human health and disease" potx
... DNA-binding domain The E/F domain is the ligand-binding domain, which contains the AF2 ligand-dependent activation domain The amino-terminal A/ B domain contains the AF1 ligand-independent activation ... of PPARs with their ligands, because of the conformational changes that are induced especially involving the transactivation domain (activation function-2, AF-2) located in the C-terminal αhelix, ... preference for binding of long chain unsaturated fatty acids, such as the essential fatty acids linoleic, linolenic and arachidonic acids, at concentrations that correlate with circulating blood...
- 15
- 437
- 0
Tài liệu Towards a framework for the study of the neural correlates of aesthetic preference pdf
... the exclusive neural correlates aesthetic preference In fact they all acknowledged that these areas in uence and are in uenced by the activity in other brain areas It might be the case that the ... whether “there are brain areas that are consistently active across subjects when they perceive a painting as being beautiful and, conversely, whether there are brain areas that are specifically active ... composition, can engage frontal-parietal attentional circuits, which enhance the processing of those attributes within the ventral visual stream (Chatterjee, 2003) He anticipated that the tasks of stating...
- 19
- 526
- 0
Healthy Child, Healthy Future: A Framework for the Universal Child Health Promotion Programme in Northern Ireland doc
... guidelines on promoting changes in behaviours that affect health, maternal mental health, and antenatal and postnatal care Incorporating interventions, where emerging evidence shows they can help, ... encouraging skin-to-skin care and the use of baby carriers • Provide information and support to fathers, as well as mothers, that responds to their individual concerns and involves active participation ... well as a general examination Where a woman is discharged from hospital before the physical examination has taken place, fail-safe arrangements should be in place to ensure that the baby is examined...
- 68
- 471
- 0
Emerging Infectious Diseases and the Threat to Occupational Health in the U.S. and Canada doc
... taken their precautions Albert Camus, The Plague Emerging Infectious Diseases and the Threat to Occupational Health in the U.S and Canada is a relevant and topical reminder that what Camus wrote about ... 2005 The South had just begun the long recovery from the devastation of Hurricane Katrina, and was bracing for the anticipated onslaught of Hurricane Rita After Katrina, local, state, and federal ... was apparent in Canada during the SARs outbreak and is alluded to in Chapter by Bunja and McCaskell Constant cross-contamination for surface removable transmission was a problem, as well as a...
- 465
- 1,005
- 0
A framework for Enhancing Airlift planning and Excution Capabilities Within the Joint Expeditionary Movement System docx
... report evaluates a set of global FSL basing and transportation options for storing war reserve materiel The authors present an analytical framework that can be used to evaluate alternative FSL ... AS-IS Theater Airlift Planning and Execution Organizational and Doctrine Shortfalls 43 AS-IS Theater Airlift Planning and Execution Training Shortfalls 46 AS-IS Theater Airlift Planning and ... Aerospace Forces: Alternatives for Jet Engine Intermediate Maintenance, Mahyar A Amouzegar, Lionel A Galway, and Amanda Geller (MR-1431-AF) This report evaluates the manner in which Jet Engine Intermediate...
- 151
- 453
- 0
Báo cáo khoa học: The Rab5 effector Rabaptin-5 and its isoform Rabaptin-5d differ in their ability to interact with the small GTPase Rab4 doc
... Second, Rabaptin-5 can participate in balancing and coordination of endo- and exocytosis through interaction with Rabphilin, a regulator of the exocytic pathway [18,19] Finally, Rabaptin-5 interacts ... gene activation caused by interaction between GAL4BD- and GAL4AD-fused proteins (b-gal) in yeast was assessed by filter a b-galactosidase assay A similar assay with GAL4BD alone as a bait revealed ... using the internal HindIII site (plasmid p5Rn5) The 3¢-end of the Rabaptin-5 coding region including the translation termination codon was amplified with the sense primer 5¢-ACAAGGAATTCAGATTCAGGAA3¢...
- 10
- 411
- 0
Báo cáo khoa học: "QARLA:A Framework for the Evaluation of Text Summarization Systems" pdf
... to the models (the x(m, a) factor in the inequality) or decreasing the similarity between automatic summaries (the x (a, a ) factor in the inequality) Finally, adding elements to A can only increase ... reliable (JACK measure) Formal constraints on any evaluation framework based on similarity metrics We are looking for a framework to evaluate automatic summarisation systems objectively using ... ORANGE (Lin, 2004), which evaluates a similarity metric using the average ranks obtained by reference items within a baseline set As in our framework, ORANGE performs an automatic meta-evaluation,...
- 10
- 517
- 0
the ethical hack - a framework for business value penetration testing
... represents the beginning of detailing the attack processes The planning and preparation is complete at this point and we move into action We cover in great detail social engineering and how to tune the ... and the format of the information contained within the deliverable The Integration chapter takes everything we ve covered and provides the roadmap for realizing all the potential value from the ... cost and instant gratification of a test as opposed to an exhaustive risk analysis Moreover, the tests are usually pointed at tactical concerns, such as “What is causing me pain today that I can afford...
- 331
- 790
- 0
Báo cáo khoa học: The isopenicillin N acyltransferases of Aspergillus nidulans and Penicillium chrysogenum differ in their ability to maintain the 40-kDa ab heterodimer in an undissociated form pdf
... clearly indicate that, whereas the 40-kDa protein is rapidly processed in P chrysogenum when incubated at 28 °C (but not at 37 °C), the A nidulans remains as a 40-kDa protein when incubated at ... conditions The results showed that there is no processing of the protein even after incubation for 60 The amount of labelled protein remaining after treatment with the A nidulans extract was approximately ... whereas the A nidulans enzyme remained in the 40-kDa form for at least 96 h of incubation No peptidases able to cleave IAT were found in the fungal extracts This indicates that processing of P chrysogenum...
- 11
- 423
- 0
báo cáo sinh học:" A framework for evaluating the impact of the United Nations fellowship programmes" ppt
... activities and inputs, the framework enables clarity about the pathway The inclusion of indicators for verification of progress and attainment of goals provides a blue print for monitoring and evaluation ... This information provides a baseline against which progress can be measured and impact determined If we don’t know the situation at the starting point we could not argue that we have added value, ... cooperation among the main stakeholders in accessing, collecting and interpreting information that supports their ability to make a judgment about the plausibility of the emerging performance...
- 8
- 520
- 0
Báo cáo hóa học: " The Armeo Spring as training tool to improve upper limb functionality in multiple sclerosis: a pilot study" ppt
... patient-preferred therapy game (e.g car racing or card playing) The mechanical-assisted training was given supplementary on customary care comprising physical and/or occupational therapy aimed at the maintenance ... supplementary mechanical-assisted training had taken place The 9HPT outcomes approximated the post-training performance levels After finishing the training program, participants rated themselves much ... and ARAT revealed even greater and for both measures significant gains relative to baseline than immediately after the intervention period, despite the fact that in the meantime no supplementary...
- 8
- 678
- 0
báo cáo hóa học:" The net cost of incorporating resistance testing into HIV/AIDS treatment in South Africa: a Markov model with primary data" pot
... second-line therapy Finally, we hypothesized that the probability of failing virologically but not having resistance is greater during a patient’s earlier years on ART and declines in later years We ... calculated for the first six intervals (three years) after first-line ART initiation, conditional on remaining alive and on ART at the site The rate of virological failure in the last interval (months ... duration on treatment was very small Table indicates the cost and other input parameters used in the analysis Second-line therapy costs nearly two-and -a- half times that of first-line therapy, as...
- 6
- 386
- 0
Clearing Services for Global Markets A Framework for the Future Development of the Clearing Industry_1 pptx
... types and categories Transaction costs in the Value Provision Network Categorisation of direct transaction costs Categorisation of clearing-related cost of capital Categorisation of clearing-related ... Titres ¸ Aktiengesellschaft American Stock Exchange Application Programming Interface Archipelago Alternative Trading Systems Bank for International Settlements Business Model Impact Matrix Bank of ... there is a whole host of topics related to clearing I believe that clearing is a topic that has always been regarded as sort of an operational thing The exchanges’ matching engines have had the...
- 38
- 542
- 0
Clearing Services for Global Markets A Framework for the Future Development of the Clearing Industry_2 pptx
... Clearing houses differentiate and calculate various margin types, most importantly the socalled ‘initial margin’ and ‘variation margin’ The two margin types can be differentiated according to their ... as novation, netting and risk management, as well as transaction/position management, collateral management and cash management The scope of netting and risk management services that a CCP can ... received the initial margin payment By increasing the initial margin, excesses in risk accumulation in the market can be avoided and the impact of potential defaults can be reduced Cf Mogford (2005),...
- 38
- 584
- 0
Clearing Services for Global Markets A Framework for the Future Development of the Clearing Industry_4 potx
... on analysing the impact that certain integration and harmonisation initiatives between clearing houses can have on the transaction costs of clearing These integration and harmonisation initiatives ... manual intervention through monitoring the clearing status of transactions and monitoring margins via a single interface At the same time, clearing houses update and replace their software and ... cross-margining approach, the partnering clearing houses hold the margin for the eligible positions in separate accounts at their respective CCPs The accounts at each partnering clearing house are...
- 38
- 469
- 0
Clearing Services for Global Markets A Framework for the Future Development of the Clearing Industry_5 potx
... with quantitative data from a questionnaire At the initial contact, stakeholders were asked to give an interview The data-gathering approach was to firstly conduct an interview in person and then ... insight into the transaction costs of clearing as well as to derive a basis for analysing the impact that network strategies have on clearing costs 4.1 Underlying Data Describes the underlying data ... that the data interpretation utilises and refers to archetypes of particular clearing members (as defined in section 2.3.2) Although these aspects are accounted for in the data interpretation, the...
- 38
- 617
- 0
Clearing Services for Global Markets A Framework for the Future Development of the Clearing Industry_6 doc
... results of the cost analysis, mainly affecting the indirect cost categories All of these factors are detailed in the following paragraphs Whereas the validation of the data on clearing house charges ... capital As outlined above, calculating, analysing and understanding the true cost of capital related to clearing is difficult for various reasons When asked to assess the cost of capital, the interviewed ... interfacing with clearing houses and integrating the received data with internal systems; the estimate therefore fails to incorporate the IT costs related to enhanced systems that manage complex tasks...
- 38
- 418
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu