efforts there is a bias of information and assistance flowing to larger and more receptive farm audiences
Báo cáo y học: "Is Phytalgic® a goldmine for osteoarthritis patients or is there something fishy about this nutraceutical? A summary of findings and risk-of-bias assessment" pot
... Symptomatic efficacy and safety of diacerein in the treatment of osteoarthritis: a meta-analysis of randomized placebo-controlled trials Osteoarthritis Cartilage 2009, Oct 14 [Epub ahead of print] ... trial reporting in terms of risk of bias, the use of random assignment, and subsequent concealment of allocation would qualify as adequate (that is, low risk of selection bias) ; it seems reasonable ... Christensen R, Bliddal H: Is Phytalgic® a goldmine for osteoarthritis patients or is there something fishy about this nutraceutical? A summary of findings and risk -of -bias assessment Arthritis...
- 3
- 279
- 0
Tài liệu Freedom of Expression on the Internet - A study of legal provisions and practices related to freedom of expression, the free flow of information and media pluralism on the Internet in OSCE participating States ppt
... examination and assessment of the efficiency, the advantages and disadvantages of various international and national content regulation measures – particularly vis-à-vis fundamental rights of ... information obtained from the OSCE participating States Albania, Armenia, Austria, Azerbaijan, Belarus, Bosnia and Herzegovina, Bulgaria, Canada, Croatia, Cyprus, Czech Republic, Denmark, Estonia, ... troubling that more than 80% of the participating States not have legal provisions in place to guarantee net neutrality Finland and Norway stand out as best practice examples with Finland having anchored...
- 238
- 2,697
- 0
Báo cáo khoa học: EmbR, a regulatory protein with ATPase activity, is a substrate of multiple serine⁄threonine kinases and phosphatase in Mycobacterium tuberculosis doc
... suggested as one of the targets for a signal transduction pathway mediated by PknA and PknB If so, this pathway could link cell division and peptidoglycan synthesis with arabinogalactan synthesis, another ... ⁄ PAGE and the loss of labeling was visualized by autoradiography ATPase activity measurements The malachite green ATPase assay The reaction buffer contained 10 lL of 10· TMD buffer, 10 lL of ... STPKs and Mstp, we demonstrate the modulation of ATPase activity and DNA-binding activity of EmbR as a possible physical mechanism to modulate its regulatory effect on emb genes On the basis of...
- 11
- 402
- 0
what is clause (A clause is a group of words that contains a subject and a finite verb)
... of clause Main clause (independent clause) These can stand alone because they express complete thoughts Subordinate clause (dependent clause) These can’t stand alone and need another clause to ... WHAT IS CLAUSE? A c laus e is a group of words that contains a subject and a finite verb Ex: I get slimmer and slimmer S A c laus e V constitutes only part of a sentence Ex: ... noun, adjective, and adverb gfgghgnggggggggdis ghxhgxsjhajhabBDJ HSGDJHGDJHSDJH VXHDVHSVDHAVVS XHS Subordinate clause There are kinds of subordinate clause: noun, adjective, and adverb - An adjective...
- 8
- 621
- 0
báo cáo khoa học: " Discovery of microvascular miRNAs using public gene expression data: miR-145 is expressed in pericytes and is a regulator of Fli1" pps
... UUCCCUAAGGACCCUU UUGACCUG ||| ||||||| 5' UCA-AUUCAGUGGAUGGCAACUGGAA 5' CAA-AUUCAGUGGAUGGCAACUGGAA 5' UUA-AUUCAGCGGAUGGCAACUGGAA 5' AUAUAUUCAGUGGAUGGCAACUGGAA (b) 3' UUCCCUAAGGACCCUUUUGACCUG || ... UUUGAAGAGAUAAGAAAACUGGAU Dog 5' CUUGAAGAGAAAACAAAACUGGAU 5' 3' 3' 3' 3' Site : Fli1 3’ UTR pos 490-497 3' UUCCCUAAGGACCCUUUUGACCUG || ||||||| 5' UGAAGUUUUUUGCCC-AACUGGAA 5' UGAAG-UUUUCACCC-AACUGGAA ... |||||| 5' UUAAAUAUUUAGGUU ACUGGAA 5' UUGCAUAUUAAGAUU ACUGGAA 5' UUAAAUAUUUAGGUU ACUGGAA 5' CUGAAUCUUUAGAUU ACUGGAA Volume 1, Issue 11, Article 108 control No significant reduction was observed...
- 12
- 242
- 0
báo cáo khoa học:" Low Sense of Coherence (SOC) is a mirror of general anxiety and persistent depressive symptoms in adolescent girls - a cross-sectional study of a clinical and a non-clinical cohort" docx
... of depression and anxiety in adults [8] Physiological health parameters such as body mass index, blood pressure and saliva cortisol correlate in a similar way to SOC and measures of anxiety and ... study was that the SOC scale appears to be an inverse measure of persistent and generalized symptoms of anxiety and depression The SOC scale and self-assessed symptoms of anxiety and depression ... in adults [10] Multivariate analyses failed to isolate SOC as a separate construct distinct from measures of anxiety and depression As the SOC items pertaining to the putative categories of meaningfulness,...
- 13
- 275
- 0
Báo cáo y học: "Road trips and resources: there is a better way" pot
... intrahospital transport Using the statistical package Crunch (Verion 4, Crunch Software, Oakland, California, USA), the three groups were analyzed for differences using a one-way analysis of variance (ANOVA) ... patients be transported with a critical care nurse, a physician and a respiratory therapist (if the patient is mechanically ventilated) Extra escort personnel are required as necessary to transport ... ventilator in a separate elevator to and from the test site All eligible patients were considered and then randomized based on the availability of informed consent and the transport bed (two available)...
- 7
- 329
- 0
Báo cáo y học: "The website contains a wealth of information regarding the management of trauma victims, as well as news about upcoming conferences and event" potx
... http://www.MDchoice.com This website contains two interactive scenarios for each of the topic areas of advanced cardiac life support, of acute leg swelling and of acute coronary syndrome The cases are detailed and ... Critical Care April 2003 Vol No Scales Overall, I found the trauma scenarios to be well presented and educational More importantly, they were actually fun to work through, and seemed to be appreciated ... feature Several of the vignettes contain unnecessary text that becomes a nuisance to skim through Wish list More scenarios in the format of the ‘trauma team leader decision scenarios’ Other links...
- 2
- 248
- 0
Báo cáo y học: "because I am something special" or "I think I will be something like a guinea pig": information and assent of legal minors in clinical trials – assessment of understanding, appreciation and reasoning'''' pot
... understood and appreciation was low – by both children and adolescents and often by parents The capacity to understand the nature of placebo was low and children and adolescents had an inadequate appreciation ... criteria and the understanding of information related to clinical trials The appreciation of children and adolescents and their parents of what a clinical trial involved and their reasoning about participation ... where access to care and availability of medication, psychotherapy and child and adolescent care is almost entirely guaranteed This study identified some categories of arguments and considerations...
- 13
- 365
- 0
Báo cáo y học: "A review of anatomical and mechanical factors affecting vertebral body integrit
... fractures are a hallmark of osteoporosis and are associated with back pain, functional disability, reduced health-related quality of life and increased mortality These associations become more significant ... Clinical applications of DXA could be directed towards measuring areal BMD in vertebral subregions from lateral scans However, the precision and accuracy of this application is yet to be evaluated ... applicable tools to measure thoracic kyphosis need to be appraised and applied to cohort studies The effect of changes in spinal curvature and pain on the recruitment characteristics of thoracic paraspinal...
- 11
- 661
- 0
A study of semantic and syntactic features of english famous love sayings and their vietnamese translation
... beliefs, arts, morals, law, custom, and any other capabilities, and habits acquired by man as a member of a society” ♦ Relation of Culture and Language The relationship between language and culture are ... Love is faithful ♦ Negative Sides of Love : They are divided into scales 18 Love is a disappointment and suffering Love is jealousy and hatred Love and money are hand in hand Man and woman in ... devices and cultural characteristics of the original FSs 25 I agree with most of translation of Vietnamese translators Their translation meet and satisfy differences in culture and language of each...
- 26
- 1,159
- 3
A study of semantic and syntactic features of idioms relating to fruits in english and vietnamese
... more seeds and flesh, can be eaten as food and usually tastes sweet: tropical fruits such as bananas and pineapples” or a part of a plant or tree that is formed after the flowers have died and ... syntactic features of English IsRTFs? What are the semantic and syntactic features of Vietnamese IsRTFs? What are the similarities and differences in the semantic and syntactic features of English and ... similarities and differences in semantic and [44] A + N Ø syntactic features What is more, basing on this comparison, we can ENGLISH A statistic summary of syntactic features of idioms relating to fruits...
- 13
- 1,304
- 8
A study of semantic and pragmatic features of the adjective warm and its vietnamese equivalents
... target language is English and the source Adjective Warm language is Vietnamese The data are classified into semantic and pragmatic features The researcher investigates the data taken from CA ... nóng A and A Warm + Warm A warm and snug pleasant/ and cheerful warm sweet and warm in its collocations + Compound Adjectives English Meaning (Pattern: Warm and +) utterances It can collocate ... linguists have studied of adjectives as well as semantic and pragmatic characteristics of the adjective Warm and its adjectives of temperature However, the adjective Warm is basically Vietnamese...
- 13
- 865
- 0
A study of syntactic and pragmatic features of indirect interrogative directives in english and in vietnamese
... and language is a really means to an end But in fact, each language's characteristics and their unique culture is reflected in language in different ways both in form, content and quality This ... English and Vietnamese? pragmatics, use of language, in English and in Vietnamese 1.4 THE SIGNIFICANCE OF THE STUDY [68, p.60] With the aim to making a study on the syntactic and pragmatic In this ... can see morphological feature such as contraction Lastly, most English and Vietnamese choose indirect in English and phonological features of coalition and assimilation are interrogative to make...
- 13
- 797
- 3
A study of syntactic and semantic features of sport headings in english and vietnamese
... headings as an autonomous language He classified headings in terms following features as typical of headings: the suppression of spatial of neutrals, nominals, verbals and particles and particularly ... the aim of achieving the set goal to find out semantic and syntactic features of Sport Headings in English and Vietnamese online newspapers” and “make a comparison between that of ESHs and VSHs”, ... ‘Mata thanks Villas-Boas’, the heading consists of a (1) “Important” is an adjective which is used to appeal the simple sentence with a N.P and a V.P readers to read the decisive moment of a...
- 13
- 1,067
- 4
A study of english and vietnamese idioms describing people's outward appearance
... This study is planned to: - investigate the syntactic and semantic features of English and Vietnamese IPOA - compare and contrast English and Vietnamese IPOA to find out the similarities and differences ... in and IPOA in particular helps us to improve our understanding and to general and IPOA in particular Besides, the findings of a contrastive achieve our ultimate goal in better teaching and learning ... made to carry out this paper, it cannot cover all structures and meanings of IPOA due to the limitation of reference materials,some of which are hard to find - An Investigation into Pragmatic and...
- 13
- 1,720
- 7
A study of english and vietnamese idioms of anger
... From the analysis above , we can affirm that English idioms in general and English idioms of anger in particular are various and interesting materials in teaching and translating Language, as W Mc ... target language Therefore, it is recommended that a good translator should try to translate idiomatically And this is the final goal of every translator The figure below is about kinds of translation ... According to Lakoff and Johnson (1980) and Lakoff (1989), the visual image “fire” is always used to represent “anger”- an abstract concept so that learners and listeners easily and correctly...
- 54
- 1,279
- 12
Developing a sytem of abbreviation and symbols for note taking in interpreting
... Administration Advantage Adventure Adverb Advertisement After Agriculture Always Answer Apartment Approximately April Arrive Association Atmosphere August Automatic Avenue Beauty Brother Captain Abbrs ... more than half of participants (64%) combined all ways above to abbreviate and symbolize In fact, there are many ways to create abbrs and symbols Some students take them from alphabet, some take ... (56%) of total amount of participants are that they tend to write as many words as possible This problem is very popular to students as they are not particularly trained Students have chance to access...
- 57
- 612
- 2
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose