effects of chronic stress on wildlife populations a population modeling approach and case study
Coastal and Estuarine Risk Assessment - Chapter 11 ppt
... shallow water that have firm substrates and high concentrations of small fish.6 Great blue herons forage in lakes, rivers, brackish marshes, lagoons, coastal wetlands, tidal flats, and sandbars, as ... incorporation of aspects of contaminant environmental fate and transport as well as remediation activities to estimate the long-term impacts of contaminant exposure on subpopulations This will not only ... based on the overall advantage that a heron would derive by foraging at that location Habitat quality is a site-specific parameter and dependent upon estimates of the quantity of available forage...
- 24
- 295
- 0
Báo cáo y học: "Prevalence of Overactive Bladder, its Under-Diagnosis, and Risk Factors in a Male Urologic Veterans Population"
... 101:52 Milsom I, Abrams P, Cardozo L, Roberts RG, Throff J and Wein A How widespread are the symptoms of an overactive bladder and how are they managed? A population- based prevalence study BJU Int ... Elinoff V and Roberts RG Validation of an OAB screener in a primary care patient population in the US; Poster Paris, France: International Continence Society Annual Meeting 2004 10 Cheung WW, Khan ... may not be high The OAB-V8 questionnaire has only been validated in a primary care setting Validation in a high risk population is still pending Our study showed that among those with OAB, only...
- 4
- 520
- 0
Báo cáo hóa học: " Solvent exposure and malignant lymphoma: a population-based case-control study in Germany" pptx
... participation, the recruitment procedure was repeated Among population controls the participation rate was 44.3% A total of 710 case- control pairs were included in the analysis Data collection ... the manuscript ES is the data manager of the German lymphoma study and participated in the statistical analysis and in the critical revision of this manuscript AN and NB who is the PI prepared, ... about among carbon tetrachloride-exposed persons, which was of borderline statistical significance This is in accordance with the results of a Canadian case- control study, including 517 cases and...
- 11
- 456
- 0
Báo cáo y học: "Association of MICA with rheumatoid arthritis independent of known HLA-DRB1 risk alleles in a family-based and a case control study" pps
... perform analysis and interpretation of the data DHa and PA helped to perform analysis and interpretation of the data and to draft the manuscript VHT and UW (and the European Consortium on Rheumatoid ... MICA-210: CCTTTTTTTCAGGGAAAGTGC, CCTTACCATCTCCAGAAACTGC [22], and bioCCATGTTTCTGCTG(L)TGCTGCT; MICA-300: GGAAGGCTGTGCAGTAATCTAGG, TCCCTTTTCCAGCCTGCC, and bioCTGTGCAGT(L)ATCTAGGCTGAAGG; and MICA-250: ... two-marker haplotype consisting of MICA-25 0A and a certain HLA-DRB1 allele should have the same transmission rate as a two-marker haplotype consisting of MICA-250G and the same HLADRB1 allele A...
- 11
- 460
- 0
Risk management in a car factoryQuản lý trong công ty sản xuất xe hơi
... such as typhoons, earthquakes, and environmental contamination We have established extensive contingency planning including the establishment of 6.2 Management of Financial Operations processes and ... implement changes as necessary for TSMC has adopted the International Standard on Environmental Management Systems (ISO 14001) as its standard for environmental compliance management TSMC Fabs 2, ... liabilities increased as a result of the issuance of corporate bonds 1.2 Major Impact on Financial Position: There was no significant impact on financial position 1.3 Future Plan on Financial...
- 4
- 296
- 0
Báo cáo y học: "Low back pain risk factors in a large rural Australian Aboriginal community. An opportunity for managing co-morbiditie" ppt
... to sex Occupation Male Female Total % Male % Female % Total Managers and Administrators Professionals Associate professionals* Tradespersons and related workers Advanced clerical and service ... McLennan W, Madden R: The Health and Welfare of Australia's Aboriginal and Torres Strait Islander Peoples In ABS Catalogue no 4704.00 AIHW Catalogue no IHW Canberra, Australian Bureau of Statistics ... the Australian Institute of Health and Welfare; 1999 National Advisory Committee on Health and Disability: New Zealand Acute Low Back Pain Guide Wellington, New Zealand, Page 10 of 12 (page number...
- 12
- 264
- 0
Tài liệu Báo cáo khoa học: "THE REPRESENTATION OF INCONSISTENT INFORMATION IN A DYNAMIC MODEL-THEORETIC SEMANTICS" ppt
... presence of intensional substitution failure is one of the important tests of a theory of propositional attitudes This mechanism is a correlate of that of Thomason [1980], with the addition of meaningful ... ~-expression and the ima6e of its denotation in the current stage of the dynamic model When the domain of the ~-expression expands, the correct denotational relationship is maintained by expanding ... example, if "John and Mary" was not identified to be the same as "Mary and John", it would be possible to have the model contain the inconsistent information that "John and Mary talk" is true and...
- 3
- 394
- 0
Corporate Taxation in a Dynamic World pot
... international tax problems Many colleagues have made fairly useful comments about my articles I wish to thank the late Aldo Chiancone, as well as Gianni Amisano, Antonio Guccione, Vesa Kanniainen, Alessandro ... worse and the rm can abandon its business activity and realize the resale value (if any) of its capital on second-hand markets; As Dixit and Pindyck (1994) point out undertaking investment takes ... the overall investment project consists of a sequence of stages: each of them can be considered as an option on the value of subsequent stages;1 an option to abandon, when market conditions get...
- 235
- 414
- 0
Affordable-Accessible Housing In A Dynamic City potx
... land Parking demand is highly variable, depending on demographic (income and age), geographic (land use density and mix), and management factors (how parking spaces are assigned, regulated and ... cheaper materials, shared walls, standardized design and materials, avoid special amenities such as elevators Fewer parking spaces, smaller spaces and driveways, surface lots rather than garages, ... For example, aging population, rising fuel prices, increasing traffic congestion, and improved urban livability are all increasing demand for urban housing and business location A rational real...
- 52
- 278
- 0
stork - living in a dynamic tropical forest landscape (blackwell, 2008)
... Research Institute, Balboa, Ancon, Panama, Republic of Panama; and Biological Dynamics of Forest Fragments Project, National Institute for Amazonian Research (INPA), Manaus, Amazonas, Brazil Tina ... side At Cairns the heavy rainfall began at and following landfall, when winds with a warm air advection profile reached Cairns Radar Radar images of Rona and Steve as they both approached the coast ... Himantandraceae, Myristicaceae and Winteraceae of the order Magnoliales; Atherospermataceae, Gyrocarpaceae, Hernandiaceae, Idiospermaceae, Lauraceae and Monimiaceae of the order Laurales (DASETT 1987) Stork-01.indd...
- 663
- 421
- 0
Báo cáo hóa học: " Steinfield, H., Mooney, H.A., Schneider, F. and Neville, L. E. Livestock in a changing landscape: Drivers" pptx
... through local, regional and international food chains that have a turnover of billions of dollars The growth of the dairy industry and the collection of milk from small-scale producers demand an improvement ... and Gerber, P., Mooney, H A. , Dijkman, J., Tarawali, S and de Haan, C Livestock in a changing landscape: Experiences and Regional perspectives (Volume 2) Pastoralism: Research, Policy and Practice ... production on nutrient management Regulatory systems with a regional approach, including utilization of animal wastes and increased storage time, are advocated The policy regarding nutrient loads...
- 7
- 241
- 0
Báo cáo hóa học: " Research Article Prerouted FPGA Cores for Rapid System Construction in a Dynamic Reconfigurable System" pot
... a simplified version of an FPGA accelerator for the Smith-Waterman algorithm used for pairwise alignment of DNA sequences with a linear gap penalty and an 8-bit datapath [28] The performance of ... provide an absolute wire assignment for each signal in an interface Mapping an interface to a set of interconnect channels each with a finite number of available wires gives an allocated interface, a ... iterations as proportional to TP and the change in critical path length proportional to a change in TEn We will assume a routing iteration takes 20 nanoseconds and that TT is 50 ms We will assume...
- 7
- 307
- 0
A behaviour based algorithm for encirclement of a dynamic target using multiple mobile robots
... Comparison of hardware and simulation results (Speed Ratio: 0.2) 50 Figure 5.12: Comparison of hardware and simulation results (Speed Ratio: 0.3) 50 Figure 5.13: Comparison of hardware and simulation ... behaviour-based system with other navigational behaviours so that a robotic team can reach navigational goal, avoid hazards and simultaneously maintain in their intended formation The other common architecture ... their paper, sometimes a shape of constant diameter like a Reuleaux triangle (see Figure 2.1) rather than a circle is formed In a Reuleaux triangle, arcs ab, bc and ca are drawn with radii equal...
- 132
- 256
- 0
Báo cáo y học: "Comparative study of control selection in a national population -based case-control study: Estimating risk of smoking on cancer deaths in Chinese men"
... than rural males, both study groups revealed a consistent pattern of the effect of smoking on risk of cancer deaths TABLE Characteristics of cases and two control groups: Population- based case- control ... spouse control design as an alternative control selection for a nationwide population- based case- control study is valid and feasible, and can produce highly acceptable research results for a fixed ... death certificate Third, social class, which is also associated with both smoking and cancer deaths, was not measured in this study, and the separate calculation of risk patterns in urban and...
- 9
- 532
- 1
Báo cáo y học: "Increased risk of peripheral arterial disease in polymyalgia rheumatica: a population-based cohort study" ppsx
... erythematosus are associated with accelerated atherosclerosis and premature coronary artery disease [6-8] Chronic inflammation is considered a major risk factor for both coronary and noncardiac vascular ... Research & Therapy Vol 11 No Warrington et al Table Risk of developing peripheral arterial disease in polymyalgia rheumatica and non-polymyalgia rheumatica Model adjustors Hazard ratio (95% confidence ... levels are associated with greater functional impairment in patients with PAD [21] In the general population, patients who have PAD and increased inflammation are at high risk for adverse cardiovascular...
- 6
- 378
- 0
Vacuum assisted birth and risk for cerebral complications in term newborn infants a population based cohort study
... other maternal and infant risk factors – to neonatal brain injury Methods This study was based on information in two national databases held by the Swedish National Board of Health and Welfare, and ... diagnostic accuracy of neonatal brain damage MRI in a small clinical series of asymptomatic newborn infants has revealed a high prevalence and high spontaneous resolution of small intracranial hemorrhages ... Intracerebral (non-traumatic) haemorrhage of fetus and newborn 52.5 Subarachnoid (non-traumatic) haemorrhage of foetus and newborn 52.6 Cerebella (non-traumatic) and posterior fossa haemorrhage of...
- 10
- 391
- 0
Báo cáo y học: "The epidemiology of medical emergency contacts outside hospitals in Norway - a prospective population based study"
... Grønlien, and Jan Nystuen from the area of Innlandet, Unni Eskeland and Olav Østebø from the area of Stavanger, and Leif Landa, Kari Hauge Nilsen, and Trond Kibsgaard in the area of Haugesund We want ... of or lower, one was dead The 256 extra patients, all interrupted missions, allocations of ambulances, and support to Zakariassen et al Scandinavian Journal of Trauma, Resuscitation and Emergency ... For data collection we chose and cooperated with a strategic sample of three EMCCs, located at Haugesund, Stavanger and Innlandet hospitals, covering Rogaland, southern part of Hordaland, Hedmark,...
- 9
- 784
- 0
Impact of chronic disease on quality of life among the elderly in the state of São Paulo, Brazil: a population-based study pptx
... estado de São Paulo, Brasil: estudio poblacional Palabras clave 27 Organização Pan-Americana da Saúde Saúde nas Américas: 2007 Washington, D.C.: OPAS; 2007 (Scientific Publication No 662) 28 Wang ... functioning scales Depression/ anxiety made a considerable impact as well, with large differences in mean score, particularly affecting mental health and role-emotional Arthritis and backpain had ... Lima et al • Chronic diseases and quality of life among elderly in Brazil Noncommunicable chronic diseases are conditions that tend to stay with individuals for a long period of time These diseases...
- 8
- 701
- 0
Cancer survival in five continents: a worldwide population-based study (CONCORD) ppt
... Cuba† France USA Canada Australia Japan Sweden Malta Norway Netherlands Austria Germany Spain Iceland Finland Italy Ireland Northern Ireland Denmark Scotland England Portugal Brazil Wales Slovakia ... Northern Ireland Scotland England Ireland Wales Slovenia Poland Czech Republic Estonia Brazil Slovakia Algeria 1·0 5·6 41·7 50·7 USA Austria Canada Australia Germany France Iceland Cuba† Netherlands ... Cuba† USA Australia Canada Sweden Japan Norway Netherlands Finland Malta Ireland Germany Spain Italy Iceland Scotland Denmark England Austria Portugal Northern Ireland Wales Czech Republic Brazil...
- 27
- 365
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25