e g on off of genes
Báo cáo y học: " The effect of interleukin-13 (IL-13) and interferon-g (IFN-g) on expression of surfactant proteins in adult human alveolar type II cells in vitro" docx
... Study Gene Name Forward Primer Probe Reverse Primer SP-A GCCATTCAGGAGGCATGTG CGGCCGCATTGCTGTCCCA GCCTCATTTTCCTCTGGATTCC SP-B TGGGAGCCGATGACCTATG CAAGAGTGTGAGGACATCGTCCACATCC GCCTCCTTGGCCATCTTGT ... SP-C CGGGCAAGAAGCTGCTTCT CCACACCGCAGGGACAAACCCT CCACACCGCAGGGACAAACCCT SP-D ACACAGGCTGGTGGACAGTTG CCTCTCCACGCTCTGCCGCGT TGTTGCAAGGCGGCATT 36B4 CCACGCTGCTGAACATGCT AACATCTCCCCCTTCTCCTTTGGGCTT TCGAACACCTGCTGGATGAC ... However, their experiment used mice, sustained overexpression of IL-13, and analyzed cathepsin H mRNA levels in the whole lung Therefore there are many differences between their experiments and...
- 13
- 256
- 0
focuses on expressions of criticizing in American and Vietnamese e-newspapers in the light of Directness/Indirectness
... to everyone has appeared: e- newspaper (newspaper in Internet) 2.4.2 E- newspapers Of all the changes of newspapers, the most significant recent development is obviously the emergence of the Internet ... are together at the beginning of the sentence, but in other case, they are separated or the writer delays the appearance of the verb Thus, one of the reason people sometimes misunderstand the information ... interpret the meaning Americans generally consider themselves to be frank, open and direct in dealing with each other They often exhibit strong emotional response to something However, according...
- 37
- 832
- 1
Challenge your thinking on theory of constraints (toc) accounting (e schragenheim)
... missing information needed to evaluate the suggestion to elevate the constraint by buying another machine We need to know how all the rest of the system will respond to an additional 50 percent ... producing 518,400 minutes of work The deal leases 50 percent of these, or 259,200 minutes At $10 every minute, the deal generates a total of $2,592,000 of T One of the missing information items is ... measure for relative desirability When we accept the order, we get additional N to our total T, but we have to give up something else Suppose the least desirable of our current market produces...
- 4
- 332
- 1
Tài liệu Notes for an Introductory Course On Electrical Machines and Drives E.G.Strangas MSU Electrical ppt
... three-phase systems are convenient to use The three sources together supply three times the power that one source supplies, but they use three wires, while the one source alone uses two The wires ... magnetic eld in the airgap of gure 2.2, representing an iron core of depth d Here we have to use two loops like the one above, and we have 18 MAGNETICS a choice of possible three Taking the one ... transformers the magnetizing current I1,ex , does not exceed 1% of the current in the transformer Its effect therefore on the voltage drop on the leakage inductance and winding resistance is negligible...
- 123
- 419
- 0
Tài liệu I MMIGRANT S MALL B USINESS OWNERS: A S IGNIFICANT AND G ROWING PART OF THE E CONOMY pdf
... owners not have a college degree There has been a great deal of focus in national immigration debates on whether preferences should be given to highly educated immigrants In relation to entrepreneurship, ... business owners not have a college degree There has been considerable focus in national immigration debates about whether preferences should be given to “highly educated” immigrants Interestingly, ... immigrants are underrepresented among construction business owners, though they are highly overrepresented among construction workers Immigrants are more likely to be business owners, but their...
- 37
- 436
- 0
báo cáo hóa học: " e differential mediating effects of pain and depression on the physical and mental dimension of quality of life in Hong Kong Chinese adults" pptx
... mediating effect of depression A series of four regression models were used to individually test each of these three-variable mediation chains The results of separate regression analyses showed ... Subjects answering yes to the question were then assessed using the Chronic Pain Grade (CPG) questionnaire [16], a seven-item instrument assessing severity in three dimensions: persistence, intensity ... the mediator, it accentuated the negative effects of depression on mental functioning The indirect effect of pain on the depression-QoL pathway was 0.043, suggesting that about 28% of the effect...
- 6
- 521
- 0
Báo cáo hóa học: " Quantitative expression analysis of HHV-6 cell receptor CD46 on cells of human cord blood, peripheral blood and G-CSF mobilised leukapheresis cells" docx
... (Becton Dickinson) Levels of CD46 expression were determined in reference to calibration beads conjugated with a known ratio of PE per bead (QuantiBRITE PE conjugated beads, Becton Dickinson) Levels ... vivo G- CSF treatment leads to a reduction of CD46 expression on the cell membrane Seya et al [16] showed a decrease of CD46 expression on leukaemia cell lines by in vitro GCSF treatment Summing ... molecules x 104 / cell tions may contribute to delayed platelet engraftment after stem cell transplantation [3] There have been evidences for latently HHV-6 infected hematopoietic progenitors reactivating...
- 4
- 272
- 0
Báo cáo lâm nghiệp: "Small mammals of a forest reserve and adjacent stands of the Kelečská pahorkatina Upland (Czech Republic) and their effect on forest dynamics" pps
... E ects of small mammals on forest regeneration were assessed according to the consumption of tree seeds and the amount of emerged seedlings The actual food offer of seeds was determined in the ... regeneration also proved it To assess the function of self-regulation mechanisms in the reserve in spite of the high consumption of seeds by small rodents the inspection of natural regeneration ... high proportion of invertebrates and small seeds (weeds, grasses), therefore its e ect on forest regeneration is negligible having quite a positive role by the consumption of animals (Z et...
- 9
- 368
- 0
Báo cáo lâm nghiệp: "Lysimetric study of eucalypt residue management effects on N leaching and mineralization" potx
... oxidation following the method described by De Leenheer and Van Hove [13] Extractable P and K were extracted using the Egner-Riehm method [14] The exchangeable base cations were extracted by M ... lysimeters (020 cm depth) Dierent letters denote signicant dierences (P < 0.05) between treatments by the Tukey multiple range test dierences among treatments, between 68.0 mg (CT) and 163.0 mg ... 24 weeks in leaching tubes Curves represent best ts of the equation Nm = No[1-exp(-kt)] Dierent letters denote signicant dierences (P < 0.05) between treatments by the Tukey multiple range test...
- 8
- 247
- 0
Báo cáo y học: " Influence of the cystic fibrosis transmembrane conductance regulator on expression of lipid metabolism-related genes in dendritic cells" doc
... Induced Gene Expression Changes in CF DC Changes in the expression level of 912 genes were induced by P aeruginosa infection Most genes belonged to the functional categories of inflammation, signaling, ... suggested a strong correlation between the presence of CFTR and expression of lipid metabolism related genes that are differently expressed in the CF DC in response to the P aeruginosa infection ... For probe sets with no GO annotations, other public databases [Mouse Protein Reference Database, Kyoto Encyclopedia of Genes and Genomes (KEGG), PubMed] were searched These genes were grouped into...
- 15
- 320
- 0
Báo cáo y học: "Growth-rate regulated genes have profound impact on interpretation of transcriptome profiling in Saccharomyces cerevisiae" pptx
... therefore expected to identify cell cycle regulated genes among the growth rate affected genes [19] Comparing a list of 430 cell cycle regulated genes [20-22] with genes regulated by the specific ... contained stress response genes, for instance genes encoding heat shock proteins and genes involved in autophagy To investigate the overlap between cluster 13 and genes found in stress response ... slower growth (Figure 3) This overlap between growth rate regulated genes and genes responding to stress indicates that the stress response shares a component with the response to changes in the...
- 13
- 223
- 0
Age related effects of apolipoprotein e genotypes on cholesterol metabolism and insulin signaling
... little data was able to verify if these observations were the causes or consequences of neurodegeneration Alternatively, the increment in the expression of ApoE may have been triggered to accelerate ... prominent symptom of AD is declination of recent memory As the disease develops, other cognitive abilities such as language, movement and sightedness begin to deteriorate The disease eventually results ... disorder and it has been widely used over the decade Mice homozygous for the recessive NIH allele of the Niemann Pick type C1 gene results in premature truncation of the protein The average lifespan...
- 145
- 335
- 0
Wireless control of bluetooth on off switches in a smart home using J2ME in mobile phones and PDAs
... type of device is going to be turned on/ off, and then a task is chosen, either a simple on/ off or a programmed schedule of an on/ off The following code example is a fragment of the system; it only ... SERVICE_TELEPHONY ); } catch (Exception e) { e. printStackTrace(); } while( !done) { try { c = server.acceptAndOpen(); RemoteDevice rdev = RemoteDevice.getRemoteDevice( c ); int size = c.getReceiveMTU(); ... ServiceRecord rec = device.getRecord( server ); rec.setAttributeValue( 0x0008, new DataElement( DataElement.U_INT_1, 0xFF ) ); Util.printServiceRecord( rec ); rec.setDeviceServiceClasses( SERVICE_TELEPHONY...
- 5
- 252
- 0
A new numerical performance analysis method of leaky bucket policing algorithm over heavy tailed on off internet traffic
... (microsec) columns of each line, we have the beginning time of the following OFF period BT of f The OFF period is the time stamp of the next line, representing the beginning time of another request ... schemes for aggregations incompetent because these schemes used to be based on the assumption that traffic can be smoothed out after levels of aggregation Heavy-tailed distributions of ON/ OFF periods, ... the exponential ON/ OFF case, the Pareto ON/ OFF case and the Weibull ON/ OFF case, which enables a numerical method that we have found to be e ective to solve the problem Since these properties...
- 156
- 209
- 0
Effects of high glucose concentrations on the expression of genes involved in proliferation and cell fate specification of mouse embryonic neural stem cells
... nervous systems, among which the neural tube defects were frequently demonstrated Though details of disease pathogenesis are complex, recent studies have demonstrated that altered expression of ... of glucose on the growth, survival, proliferation and cell-fate specification of NSCs isolated from the telencephalon of embryonic mice, and on the expression of some developmental control genes ... metabolic changes Hence, it is suggested that further studies are required to understand the effect of high glucose on the expression of some developmental genes encoding morphogens such as SHH...
- 257
- 293
- 0
Báo cáo y học: "Effects of Losartan on expression of connexins at the early stage of atherosclerosis in rabbits"
... a) glyceraldehyde phosphated dehydrogenase (GAPDH): forward: 5’-GCGCCTGGTC ACCAGGGCTGCTT-3’, reverse: 5’-TGCCGAAGTG GTCGTGGATGACCT-3’; b) Cx40-1: forward: 5’-ATGCACACTGTGCGCATGCAGGA-3’, reverse: ... 5’-CAGGTGGTAGAGTTCAGCCAG-3’; c) Cx43-1: forward: 5’-CATCTTCATGCTGGTGGTGT-3’, reverse: 5’-TAGTTCGCCCAGTTTTGCTC-3’ Computer-assisted primer selection (Gene Runner, Hastings Software) was conducted ... the early stage of atherosclerosis, the number of Cx43 gap junction plaques increased and the diameter of gap junction became smaller in during endometrial thickening During the progression of...
- 8
- 467
- 0
Báo cáo y học: "Functional genomics analysis of low concentration of ethanol in human hepatocellular carcinoma (HepG2) cells. Role of genes involved in transcriptional and translational processes"
... down-regulated gene expression The gene expression pattern between the two groups revealed a relatively similar pattern, suggesting that only few genes are changed with exposure of a low Table Ethanol-regulated ... The other ethanol-regulated genes were not found to be associated with any specific pathway Table Gene ontology in terms of biological processes of the ethanol-regulated genes in HepG2 cells Gene ... levels of ethanol-regulated genes determined by real time RT-PCR Induction ratios of each gene (fold change) by ethanol were calculated using expression level, normalized to the level of the control...
- 8
- 702
- 0
Phương pháp điều khiển On-Off , PI và điều khiển PID thông qua Card AD giao tiếp với máy tính PCL818.
... http://www.ebook.edu.vn 29 BASE+10 BASE+11 BASE+12 BASE+13 BASE+14 BASE+15 N/A Byte cao Digital Input Counter Counter Counter N/A Cho phép counter Byte cao Digital Output Counter Counter Counter Điều ... động lực) http://www.ebook.edu.vn 49 dùng TRIAC đóng ngắt nguồn điện lưới cung cấp cho lò áp qua zero(zero switching) Với điều khiển này,trong đồ án chọn nguyên tắc điều rộng xung, đảm bảo cung ... số Seebeck 51μV/°C 20°C http://www.ebook.edu.vn 19 Loại T : kết hợp đồng với constantan, đồng cực dương constantan cực âm Hệ số Seebeck 40μV/°C 20°C Loại K : kết hợp chromel với alumel, chromel...
- 96
- 1,132
- 1
Firm-specific Factors Affecting on cost of equity in Vietnam
... applied to emerging markets Using sovereign credit rating: Erb et al (1996a) estimated a time series cross-section regression and the model forces a linear relation with the negative slope coefficient ... be in different ways First, to determine whether or not the relationships are consistent over the years, the research needs to be more extensive Second, it is interested to know what type of effect ... negative related to the cost of 37 equity Most coefficients confirm the expected relationship, documented by previous studies With the exception result between DE and cost of equity, the paper...
- 57
- 451
- 0
A STUDY ON SOLUBILIZATION OF EXCESS SLUDGE BY HIGH SPEED ROTARY DISK PROCESS
... in Fig.1 Different concentrations of sludge were processed the experiments The sludge samples (10L each) were input at the inlet of fixed upper disk The samples were treated though the high rotary ... seemed no significant change with the increase of recycle time and became relatively steady-state after 50 times recycle treatment with a particle size of 10 mm There is no difference between ... due to the function of grind between two disks on the samples However, it seemed no effect on bacteria because of their small size On the other hand, the concentration of MLSS had no effect on...
- 6
- 377
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008