dr expression and lower levels of naïve cd4 t cells in iris patients than in asymptomatic clinical progressors
Báo cáo y học: "Differentiation of naive CD4+ T cells towards T helper 2 cells is not impaired in rheumatoid arthritis patients" pps
... Berg WB: Role of interleukin-4 and interleukin-10 in murine collagen-induced arthritis Protective effect of interleukin-4 and interleukin-10 treatment on cartilage destruction Arthritis Rheum 1997, ... primary T- cell stimulation and can interact with antigen-presenting cells Here naive cells can differentiate into memory effector Th cells Factors that drive the initial expression of IL-4 (as the ... demonstrates that such a defect is not present in RA patients In contrast, differentiation by IL-7 and IL-4 towards Th2 cell activity was increased in RA patients Methods Patients Mononuclear cells...
- 8
- 269
- 0
Báo cáo khoa học: Regulation of the expression and subcellular localization of the taurine transporter TauT in mouse NIH3T3 fibroblasts doc
... and the rate constant for the taurine efflux (min)1) at each time point was estimated as the negative slope of the graph between the time point and the proceeding time point The taurine efflux at ... possible that creatine binds to TauT with low affinity and competitively reduces active taurine uptake This was not investigated further From Fig it is seen that active taurine uptake in NIH 3T3 cells ... following hypotonic incubation and it was suggested that this effect reflected an inhibition of a protein tyrosine phosphatase [20] Several of the serines, threonines and tyrosines in the intracellular...
- 13
- 524
- 0
Báo cáo y học: "Chemokine receptor expression and functional effects of chemokines on B cells: implication in the pathogenesis of rheumatoid arthritis" ppt
... that they have no competing interests Authors' contributions TN designed the study, and carried out data analysis, interpretation, and manuscript preparation KT and YK participated in the data ... greater than that of CD27- B cells, the increased proportion of CD27+ B cells in the synovium might be related to their higher chemotactic activity In contrast, the expression of CCR6, CCR7 and ... [22-29] Therefore, interactions between the chemokines and the chemokine receptors might contribute to B cell migration into the synovial tissue in patients with RA In the RA synovium, the proportion...
- 11
- 343
- 0
báo cáo khoa học: "Expression and prognostic significance of cancer-testis antigens (CTA) in intrahepatic cholagiocarcinoma" ppt
... for clinical trials of vaccine immunotherapy for multiple cancer patients, but the utility of CTA immunotherapy against patients with IHCC remains investigated In this study, using three CTA markers ... Materials and methods Patients The study was approved by the research ethics committee of our institutions, and informed consent was obtained from each patient A total of consecutive 102 patients ... assigned to any extent of immunostaining in sections and further graded into four groups: + : < 5% of tumor cells stained; ++ : 5-25% of tumor cells stained; +++ : > 25-50% of tumor cells stained;...
- 6
- 414
- 0
báo cáo khoa học: "Gene family structure, expression and functional analysis of HD-Zip III genes in angiosperm and gymnosperm forest trees" pps
... treatment and to the control untreated group The first treatment removed the shoot apex, which involved cutting off the top part of plants down to LPI inclusively The second treatment applied an inhibitor ... after the treatments were applied, from internodes LPI14 to 16 and consisted of whole stem segments without the bark For the NPA treated trees, the sampling consisted of stems segments without ... line on six lines and on six control trees For analyses, the data were placed into bins of 0.10 to 0.25 mm Statistical analyses of phenotypic and RT-qPCR data Statistical treatment of phenotypic...
- 17
- 261
- 0
Báo cáo y học: "Altered expression of T cell Immunoglobulin-Mucin (TIM) molecules in bronchoalveolar lavage CD4+ T cells in sarcoidosis" docx
... decreased TIM-3 expression in BALF CD4+ T cells of patients, we also analyzed the levels of galectin-9 in these cells and found that the expression of galectin-9 in BALF CD4+ cells from patients was similar ... in the lungs of patients with Löfgren's syndrome and those without The triggering event is the presentation of an (unknown) antigen by antigen-presenting cells (APC) to T cells In the lungs of ... suggesting that TIM-1 controls critical regulatory pathways in the immune system Studies on mice have indicated that TIM1 is involved in T helper cell differentiation and suggested that the protein...
- 12
- 192
- 0
Báo cáo y học: "TLR2 and TLR4 triggering exerts contrasting effects with regard to HIV-1 infection of human dendritic cells and subsequent virus transfer to CD4+ T cells" docx
... beginning to study the putative effect(s) of bacterial products that can bind TLRs in DCs in the context of HIV-1 infection [30,31] It has been recently reported that productive HIV-1 infection ... indicator cells Results depicted in Fig 8A indicate that the TLR4 ligand LPS acted as a strong inducer of IFNα/β in IM-MDDCs while TLR2, 5, and triggering did not result in the secretion of type-I ... point following initiation of the co-culture (i.e days) and was rapidly lost thereafter is indicative of a modulatory effect on intricate interactions between HIV-1 and IM-MDDCs The loss of the...
- 16
- 288
- 0
Applying macromolecular crowding to promote the expansion and adipogenic differentiation of human mesenchymal stem cells in vitro; an effect of matrix reciprocity
... 2001;Function and interactions of integrins Cell Tissue Res (3):285-298 41 Mould AP, Askari JA, Aota SI, et al 1997;Defining the topology of integrin alpha5beta1-fibronectin interactions using inhibitory ... partners in osteolytic tumor growth and metastasis Matrix Biol (6):341-352 95 Sottile J, Hocking DC 2002;Fibronectin polymerization regulates the composition and stability of extracellular matrix ... fibronectin that retain attachment-promoting activity Proc Natl Acad Sci USA :1224-1227 44 Danilov YN, Juliano RL 1989;(Arg-Gly-Asp)nalbumin conjugates as a model substratum for integrin-mediated...
- 9
- 423
- 0
Báo cáo khoa học: A functional polymorphism at the transcriptional initiation site in b2-glycoprotein I (apolipoprotein H) associated with reduced gene expression and lower plasma levels of b2-glycoprotein I docx
... have not found causative mutations, other than the Cys306Gly and Trp316Ser We therefore hypothesized that the 5¢ flanking region of b2GPI harbors functional mutations that determine the interindividual ... demonstrate that the )1CfiA mutation at the transcriptional initiation site is causative, which regulates b2GPI gene expression at the transcriptional level that ultimately affects b2GPI plasma levels ... according to the manufacturer’s instructions Bovine serum albumin was used as standard to determine the protein concentrations in the liver lysates Plasmid DNA constructs The 5¢ flanking region of...
- 9
- 462
- 0
Báo cáo y học: "HLA-DR regulation and the influence of GM-CSF on transcription, surface expression and shedding
... of intracellular HLA -DR than septic patients Figure shows the intracellular and surface expression of HLA -DR from septic patients and healthy controls In septic patients the intracellular expression ... that the transcriptional expression of HLA -DR mRNA was not altered in sepsis In the present study, it has been demonstrated that the transcription of HLA -DR in septic patients was significantly ... regulation of HLA -DR at the level of gene transcription has been investigated in patients with sepsis, this correlated with high cortisol levels and was thought to be acting on the down regulation...
- 11
- 618
- 0
Báo cáo y học: "Resistance to IL-10 inhibition of interferon gamma production and expression of suppressor of cytokine signaling 1 in CD4+ T cells from patients with rheumatoid arthritis" ppsx
... 5a) These results indicate that IL-6 is the dominant STAT3-activating factor contained in sera of active RA patients The lack of STAT1 activation by RA serum suggests that much higher concentrations ... IL-10-induced STAT1 phosphorylation was not detected in either RA CD4+ T cells or normal CD4+ T cells (Fig 4a) These results indicate that STAT3 is the major IL10-activated STAT in CD4+ T cells, and ... elucidate the resistance of CD4+ T cells to this direct inhibition in RA, we investigated the production of IFN-γ after CD3 and CD28 costimulation in the presence of IL-10, the induction of STAT1 and...
- 11
- 604
- 0
Báo cáo y học: " Elevated expression of both mRNA and protein levels of IL-17A in sputum of stable Cystic Fibrosis patients" potx
... were included in the study Characteristics of CF patients and control subjects are shown in Table Twenty-two of the CF patients were using inhaled antibiotics as maintenance treatment 21 patients ... levels of IL-22 and IL-23 in sputum of stable CF patients and to relate expression of these cytokines in sputum to the chronicity of airway infection Methods Study population and study design Adult ... protein and mRNA levels and also of IL-23 mRNA in sputum of clinically stable CF patients as compared to healthy controls, thus suggesting a potential role of Th17 cells in the pathophysiology of...
- 8
- 288
- 0
Báo cáo y học: " Effects of prostratin on Cyclin T1/P-TEFb function and the gene expression profile in primary resting CD4+ T cells" doc
... expression, consistent with the proposal that the prostratin induction of Cyclin T1 /P-TEFb plays a role in the stimulation of the NL4-3-Luc-Tat+ virus We note that it is possible that prostratin may also ... reporter virus encoding a non-functional Tat protein (NL4-3-Luc-Tat-) was used to infect resting CD4+ T cell In contrast to the virus expressing a functional Tat protein, the Tat- virus infections ... activity in vitro, are affected by prostratin treatment For detection of total 7SK levels, we carried out Northern blots of total RNA isolated from control and prostratin-treated cells (Fig 3A) Total...
- 14
- 283
- 0
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf
... 5¢-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3¢; Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTCGCTGAAGACGTGGGTTCTAACAAG GGTGCT-3¢; Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢; ... band migrated between and kDa (Fig 2) These data indicate that both peptides accumulate in inclusion bodies, and that Ab(L1–40) is the dominant protein in the inclusion bodies In contrast, the ... effects on hippocampal neurons, causing inhibition of MTT reduction within h of treatment and neuritic degeneration and cell loss upon prolonged treatment Importantly, these results indicated that...
- 16
- 691
- 0
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx
... able to reconstitute the activity by using the treatment that successfully restored the bacterial protein [21,33] Interestingly, the same difficulty in stripping off the metallocofactor from the ... it from the protein at acidic pH Both the different sensitivity to EDTA, and the lower kcat value exhibited by the human protein with respect to the bacterial counterpart suggest that the active ... in the brain of a murine model of the syndrome [18,19] Interestingly, picolinate is reportedly able to prevent the neurotoxic effects of quinolinate in the rat central nervous system, suggesting...
- 14
- 601
- 0
Tài liệu Báo cáo Y học: Regulated expression and intracellular localization of cystatin F in human U937 cells pptx
... are interesting in this context Although a detailed study of the cystatin F transport route was beyond the scope of the present investigation, the fact that cystatin F is present in significant ... underestimate of the real production of cystatin F in U937 cells The high portion of intracellular cystatin F led us to fractionate cells to determine the localization of the inhibitor Initially cells ... not affect the degradation Thus, cystatin F has the potential to regulate two different enzyme activities relevant for antigen presentation In this context, it is intriguing that the cystatin...
- 10
- 536
- 0
Tài liệu Báo cáo khoa học: Functional expression and mutational analysis of flavonol synthase from Citrus unshiu pptx
... for site-directed mutagenesis by the siteelimination technique according to Zakour [32] Hybridization of the mismatch primer 5¢-CTCCACCTCCATG GATTTTATTTTCC-3¢ to the FLS 5¢ coding region introduced ... spectropolarimeter was equipped with a cylindrical quartz cuvette with a pathlength of 0.05 cm The temperature of the cell holder was maintained at °C by a circulating water thermostat and the instrument ... marginal effect on the enzyme activity [7] On the assumption that Gly68, Pro207 or Gly261 might be required for structural integrity of the active FLS, point mutations were initiated aiming at the...
- 9
- 864
- 0
Báo cáo khoa học: Expression and physiological role of CCN4⁄Wnt-induced secreted protein 1 mRNA splicing variants in chondrocytes potx
... consistent with the total outcome of the constitutive expression of the full-length and the differentiation stage-dependent expression of WISP1v in vitro Effect of overexpression of CCN4/WISP1 and ... in growth plate chondrocytes Distribution of CCN4/WISP1 proteins in growth cartilage in vivo In general, the distribution of a protein in a certain tissue is closely associated with its function ... structures of the corresponding mRNAs and deduced translational products are illustrated Owing to the alternative splicing, a frameshift mutation was introduced, thus resulting in a premature termination...
- 11
- 435
- 0
Báo cáo khoa học: Sulfation of hydroxychlorobiphenyls Molecular cloning, expression, and functional characterization of zebrafish SULT1 sulfotransferases docx
... note that both of them can catalyze the sulfation of the two hydroxychlorobiphenyls tested, with SULT1 ST1 being more effective than SULT1 ST2 Table shows the kinetic constants determined for the ... regulation of the activity of the zebrafish ST by these divalent metal cations and their modes of action Fig Effects of divalent metal cations on the sulfating activity of the zebrafish SULT1 STs and ... maintained in aquaria heated to 28 °C [24] In their natural habitat, however, they are subjected to fluctuation in body temperature An intriguing issue therefore is related to the stability of...
- 8
- 537
- 0
Báo cáo Y học: Expression and purification of the recombinant subunits of toluene/ o-xylene monooxygenase and reconstitution of the active complex potx
... isocratic elution with 8% (v/v) acetonitrile in water containing 0.1% (v/v) trifluoroacetic acid The identification of the flavin cofactor was obtained by comparing the retention time of the eluted ... the expected molecular size of the polypeptides, all the proteins of interest were present in the soluble fraction of the induced cell in the case of the expression of pET22b(+)/touBEA and /touC, ... and D, and changing the concentration of each single component Figure shows the effects on the rate of reaction of increasing ratios of Tomo F, Tomo C and Tomo D with respect to Tomo H in the presence...
- 11
- 478
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25