0

don apos t invoke programs with username and password on command line

Effects of simultaneous doping with boron and phosphorous on the structural, electronic and optical properties of silicon nanostructures

Effects of simultaneous doping with boron and phosphorous on the structural, electronic and optical properties of silicon nanostructures

Vật lý

... Initially the system is in its ground state and the electronic excitation occurs with the atomic positions fixed in this configuration After the excitation, due to the change in the charge density, relaxation ... Vanderbilt ultrasoft pseudopotentials [27] for both the determination of the structural and electronic properties and norm-conserving pseudopotential within the local density approximation (LDA) at the ... different size, and then we explore different configuration by varying the distance between the dopants 2.2.1 Structural properties and formations energies First we fix out attention on the structural...
  • 8
  • 1,024
  • 0
báo cáo hóa học:

báo cáo hóa học:" Effect of combined treatment with alendronate and calcitriol on femoral neck strength in osteopenic rats" doc

Hóa học - Dầu khí

... improvements in bone mass and strength at the femoral neck than either intervention alone Therefore, we aimed to investigate the effect of combined treatment with alendronate and calcitriol on bone mass ... comparison test) Total BMC at the parts of the femoral neck was significantly lower in the saline-treated OVX compared with the sham group Alendronate treatment, with or without calcitriol, induced ... significantly improved bone fragility owing to ovariectomy compared with the saline-treated OVX rats For this reason, we also believe it is of interest that OVX rats treated with the combined treatment...
  • 10
  • 431
  • 1
Báo cáo khoa học:

Báo cáo khoa học: "Effect of sedation with detomidine and butorphanol on pulmonary gas exchange in the horse" pps

Báo cáo khoa học

... venous concentration ratios of each gas (retention and excretion, respectively) depend http://www.actavetscand.com/content/51/1/22 on its blood-gas partition coefficient and the VA/Q (the ratio of ... atrium through the pigtail catheter (injection time sec), and the blood temperature was then measured in the pulmonary artery at the tip of the Swan-Ganz catheter and the cardiac output was computed ... reported in the horse to date, it is not possible to separate the relative contributions of pulmonary and cardiovascular alterations to the development of impaired arterial oxygenation Horses that...
  • 9
  • 338
  • 0
Báo cáo y học:

Báo cáo y học: "Effects of plasma expansion with albumin and paracentesis on haemodynamics and kidney function in critically ill cirrhotic patients with tense ascites and hepatorenal syndrome: a prospective uncontrolled trial" ppt

Báo cáo khoa học

... pulmonary vasculature and part of the aorta by a thermistor-tipped arterial line inserted into one of the femoral arteries and advanced to the aortic bifurcation The mean transit time and the ... systems are important effects of paracentesis and that the decreased vascular tone may reflect not a deterioration of circulatory dysfunction but less demand for vasoconstrictor activation in the ... positively inotropic substances for days after treatment of the condition leading to ICU admission without an improvement in kidney function, and they had to fulfil the diagnostic criteria established...
  • 9
  • 568
  • 0
Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt

Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt

Báo cáo khoa học

... encoding the mature protein (5¢ primer, 5¢-CATGCCATGGCCAGTAGTCAGCCTGACCCTACT CCAG-3¢; 3¢ primer, 5¢-CGCGCGGGATCCTTAGTG ATGGTGATGGTGATGGGTGACCGGTTTTTTGG Ó FEBS 2004 Interaction of human TCR with superantigen ... CCCTACTCCAG-3¢ and 3¢ primer, 5¢-GGTTATCATA TAAAGATCTCAAATTACCC-3¢, for the second PCR the primers were: 5¢ primer, 5¢-GGGTAATTTGAGATC TTTATATGATAACC-3¢ and 3¢ primer, 5¢-CGCGCGG GATCCTTAGTGATGGTGATGGTGATGGGTGACC ... GATCCTTAGTGATGGTGATGGTGATGGGTGACC GGTTTTTTGGTAGGTGAAC-3¢ The third PCR was carried out using PCR products, the first PCR 5¢ primer and the second 3¢ primer The final amplified DNA was ligated into pET26b and...
  • 9
  • 485
  • 0
Engineering AnalysisInteractive Methods and Programs with FORTRAN, QuickBASIC, MATLAB pdf

Engineering AnalysisInteractive Methods and Programs with FORTRAN, QuickBASIC, MATLAB pdf

Cơ khí - Chế tạo máy

... equations into matrix equations and to the methods of finding their solutions, specifically the Gaussian Elimination method An apparent application of the matrix equation is the transformation of the ... in the Problems listed at the end of this chapter for the readers to practice on the matrix multiplications based on Equation It is of interest to note that the square of the length of a vector ... statements The true, or, false condition of the expression inside the outer pair of parentheses directs the computer to execute the statement following the parentheses or the next statement immediately...
  • 354
  • 995
  • 1
Engineering Analysis Interactive Methods and Programs with FORTRAN, QuickBASIC, MATLAB, and Mathematica doc

Engineering Analysis Interactive Methods and Programs with FORTRAN, QuickBASIC, MATLAB, and Mathematica doc

Kĩ thuật Viễn thông

... equations into matrix equations and to the methods of finding their solutions, specifically the Gaussian Elimination method An apparent application of the matrix equation is the transformation of the ... in the Problems listed at the end of this chapter for the readers to practice on the matrix multiplications based on Equation It is of interest to note that the square of the length of a vector ... statements The true, or, false condition of the expression inside the outer pair of parentheses directs the computer to execute the statement following the parentheses or the next statement immediately...
  • 354
  • 807
  • 0
Interactive Methods and Programs with FORTRAN, QuickBASIC, MATLAB - Engineering Analysis docx

Interactive Methods and Programs with FORTRAN, QuickBASIC, MATLAB - Engineering Analysis docx

Kĩ thuật Viễn thông

... equations into matrix equations and to the methods of finding their solutions, specifically the Gaussian Elimination method An apparent application of the matrix equation is the transformation of the ... in the Problems listed at the end of this chapter for the readers to practice on the matrix multiplications based on Equation It is of interest to note that the square of the length of a vector ... statements The true, or, false condition of the expression inside the outer pair of parentheses directs the computer to execute the statement following the parentheses or the next statement immediately...
  • 354
  • 1,170
  • 0
Báo cáo y học:

Báo cáo y học: "Characteristics of T-cell large granular lymphocyte proliferations associated with neutropenia and inflammatory arthropathy" ppt

Báo cáo khoa học

... inflammatory arthropathy or with no arthritis symptoms Our results demonstrate that patients with RA and neutropenia represent a continuous spectrum of T- LGL proliferations although monoclonal expansions ... and recurrent infections as well as RA were controlled In all of the patients, arthritis responded well to the treatment Two patients with FS and polyclonal T- LGL lymphocytosis were treated with ... alone (5 to 10 mg daily) was given to patients for 12 to 34 months (median duration 20 months) as a continuation of previous arthritis treatment No response was noted in these patients, but anemia...
  • 12
  • 565
  • 0
Báo cáo y học:

Báo cáo y học: "Collagen-specific T-cell repertoire in blood and synovial fluid varies with disease activity in early rheumatoid arthritis" pot

Báo cáo khoa học

... AGGCTCATCCATTATTCAAATAC BV14 GGGCTGGGCTTAAGGCAGATCTAC BV15 CAGGCACAGGCTAAATTCTCCCTG BV16 GCCTGCAGAACTGGAGGATTCTGG BV17 TCCTCTCACTGTGACATCGGCCCA BV18 CTGCTGAATTTCCCAAAGAGGGCC BV19 TCCTCTCACTGTGACATCGGCCCA ... PCT/IB2008/053152National Patent 13 Authors' contributions FR has made substantial contributions to the conception and design of the study, and analysis and interpretation of the data He drafted the manuscript ... Therefore, it may be suggested that the acute event relies on those CDR3s that belong to T cells that can to home to the synovia Thus, a therapeutic intervention may focus on these T cells without the...
  • 18
  • 340
  • 0
Báo cáo y học:

Báo cáo y học: " No genetic evidence for involvement of Deltaretroviruses in adult patients with precursor and mature T-cell neoplasms" doc

Báo cáo khoa học

... using two ribosomal -1 frame shifts, and the second frame shift with the transcription start site of the pol ORF lies within this region [1] The high degree of conservation of this region is thus ... complete isolates have been published yet The tree is not intended to set up a phylogeny but to illustrate the genetic relationships between the isolates III and HTLV-IV isolates have not yet been ... first region corresponds to the proline tRNA binding site; the start of the pol ORF is underlined in the second region (site of ribosomal frameshift) lates A common feature of the Deltaretrovirus...
  • 7
  • 428
  • 0
Chapter 9: Working with Selections and Selection Layers

Chapter 9: Working with Selections and Selection Layers

Thiết kế - Đồ họa - Flash

... want to with your selection! Alternatively, you can use the Convert Layer to Selection button (located on the Layers palette next to the Selection title) instead of selecting the function from the ... Manga Studio’s standard tone sets Located in the Default\Computones folder of the Tones Palette, these tone sets include: • Emphasis: Tones that are used to convey strong emotions or actions • ... these to manipulate the position of the tone on the page within its pasted area (that means any areas on the page that don t have tone on them will remain unaffected) The three buttons work as follows:...
  • 39
  • 754
  • 0
The effects of clay a m e n d m e n t and composting on metal speciation in digested sludge liang qiao

The effects of clay a m e n d m e n t and composting on metal speciation in digested sludge liang qiao

Môi trường

... 953 Table I The effect of factoring in the dilution by red mud addition on total metal content in sludge compost and the metal content associated with the silicates Metals (rag kg t) ,[ At day ... effect six tested metals Based on the redox potential for the redox reaction with other metal ions, the Zn 2+ can be expected to stay in ionic form in solution Since the total concentration of ... in Table confirming that indeed some metals were associated with silicates Some solids residue still remained even after reaction with HF Total metal concentration To ascertain the concentration...
  • 14
  • 1,026
  • 0
 Báo cáo y học:

Báo cáo y học: "Inhalation with Fucose and Galactose for Treatment of Pseudomonas Aeruginosa in Cystic Fibrosis Patients"

Y khoa - Dược

... (inhalation: inhalation + antibiotics) This ensured that most of the patients were treated with antibiotics and that an effect of inhalation alone and inhalation with antibiotics could be evaluated ... patients studied and the comparison of inhalation versus inhalation + antibiotics Moreover, patients with exacerbation but not patients with stable disease were investigated Inhalation with fucose/galactose ... serum protein levels with inhalation alone but not with combination therapy It is tempting to speculate that fucose/galacatose inhalation may be able to clear bacteria from the lungs without inducing...
  • 6
  • 618
  • 0
English with photos and words -Little Picture Dictionary

English with photos and words -Little Picture Dictionary

Kỹ năng nói tiếng Anh

... late, it is done after the expected time or is done towards the end of the day -6- magically monthly When something is When something done with magic and is done monthly, mystery, it is done it ... in the middle left is the The boy on the right is something is tiny, it is taller than the boy is tinier than the boy tiniest of the the tallest of the three is very small on the left on the ... average in than the boy size on the right littlest long loud The boy on the left is the littlest of the three When something is long, it is not short The opposite of loud is quiet multicolored...
  • 112
  • 926
  • 40
TChon 14 PRESENT PERFECT WITH SINCE AND FOR.doc

TChon 14 PRESENT PERFECT WITH SINCE AND FOR.doc

Tiếng anh

... electricity light in the kitchen It was some thing quite unexpected: a house with electricity but without a kitchen light It was quite puzzling because our kitchen was a large room, perhaps the largest ... night g Yes, that’s fine h Oh, no I don t really like watching it Keys 12345678- V Give the correct form of the verbs in the blankets: My father (listen) ………………………………… to the radio last night Mr ... September day It was not really a new house It was a hundred and four years old, but it was new to us The house had running water, gas and electricity but for some reasons, there was no electricity...
  • 2
  • 582
  • 8
The essence of object oriented programming with java and UML

The essence of object oriented programming with java and UML

Kỹ thuật lập trình

... collected by the Java run-time constructor An operation that creates an object and defines its initial state For complex objects, construction can be a significant activity, and cause the constructors ... Class Notation The basic UML notation for a class is a rectangle with three horizontal parts The top part is used to hold the name of the class The middle part shows attributes, and the bottom is ... concepts of object orientation Object orientation has many important concepts, and of course, its own vocabulary It is very important for you to understand the main concepts, and to be familiar with...
  • 364
  • 500
  • 0
Reported Speech with Infinitive and Geủnd

Reported Speech with Infinitive and Geủnd

Tiếng anh

... …………………………………………………………………………… 11 “ I can t wait until August to go to Paris for my holiday.” said my sister ……………………………………………………………………………… 12 “You stole the money I put on the table this morning.” said my brother ……………………………………………………………………………… ... more than two of these at once.” Said the doctor, handing me a bottle of pills …………………………………………………………………………………………………… 14 “It’s a very night evening Why don t we go for a walk.” Mary suggested ... “No, let me pay for the meal Not you.” David insisted ………………………………………………………………………………… 14 “You’ve won the gold medal Congratulation!” said the teacher ………………………………………………………………………………… 15 I’m terribly...
  • 5
  • 32,825
  • 878

Xem thêm