distribution on the theory of allied species having a common descent
Tài liệu The Compleat Strategyst - Being a Primer on the Theory of Games of Strategy pdf
... Periodically, RAND Corporation researchers publish with commercial presses These books are not available from RAND but can be requested directly from the publisher, except in cases where the rights ... requested directly from the publisher, except in cases where the rights have reverted to RAND and we have republished a new edition ...
- 286
- 512
- 0
Project Gutenberg’s Essays on the Theory of Numbers, by Richard Dedekind pptx
... consideration of the series of so-called natural numbers In what way the gradual extension of the number-concept, the creation of zero, negative, fractional, irrational and complex numbers are ... quantitative relations, also irrational, and besides algebraic, also transcendental quantitative relations are conceivable All the more beautiful it appears to me that without any notion of measurable ... is a similar transformation of S and ψ a similar transformation of φ(S), then is the transformation ψφ of S, compounded of φ and ψ, a similar transformation, and the associated inverse transformation...
- 78
- 359
- 0
A Treatise on the Theory of Invariants by Oliver E. Glenn pot
... as the resultant of ∂x1 , ∂x2 : a0 − R= a1 2a1 a0 2a2 a1 a2 2a1 a3 2a2 a2 a3 (39) = (a0 a3 − a1 a2 )2 − 4 (a0 a2 − a2 ) (a1 a3 − a2 ) 1.3.5 Universal covariants Corresponding to a given group of ... subjected to a definite kind of a transformation, like the transformation of the points in a plane by a linear transformation of their co¨rdinates Invariant theory treats of the properties of o the system ... a3 − a1 a2 )2 + 4 (a0 a2 − a2 ) (a1 a2 − a2 )] Chapter THE PROCESSES OF INVARIANT THEORY 3.1 Invariant Operators We have proved in Chapter II that the system of invariants and covariants of a form...
- 221
- 355
- 0
Báo cáo toán học: "On the Theory of Pfaffian Orientations" pot
... and the bounded faces are called inner faces Let G be a plane graph A subgraph of G consisting of the vertices and the edges embedded on the boundary of a face will also be called a face If a ... g-graph A Pfaffian orientation D0 of G0 such that each inner face of each 2-connected component of G0 is clockwise odd in D0 is called a basic orientation of G0 Note that a basic orientation always ... computing the permanent of a matrix A by changing o the signs of some entries of A so that the determinant of the resulting matrix equals the permanent of A Let us call a (0, 1)-matrix A convertible...
- 19
- 258
- 0
Báo cáo toán học: "On the Theory Of Pfaffian Orientations. II. T -joins, k-Cuts, and Duality of Enumeration" potx
... = as a linear combination of 4g Pfaffians, and hence it may be determined efficiently for the graphs embeddable on an arbitrary fixed orientable surface It is natural to ask whether there is an analogy ... generating function of the multicuts of a graph and we derive an important relation between it and the generating function of the eulerian subgraphs of the same graph It is well known that for a ... integer Let G be the class of graphs G = (V, E) such that the edges are partitioned into at most k classes and the variables xe are equal in each class Then there is a polynomial algorithm which,...
- 11
- 399
- 0
essays on the theory of auctions and economic rents
... determines what type of auction is in place, and firms bid their valuations to acquire the item There are close analogies between auction theory, negotiation markets, and price theory of market exchanges ... point, all markets clear Industrial Organization (IO) theory of the firm, relaxes the first welfare theorem assumptions, and the most important concern remains as the social planner's role to attain ... strategies are discussed CHAPTER THEORETICAL BACKGROUND The traditional approach to resource acquisition has been various applications of the neoclassical economic theory of the firm, which treats firms...
- 191
- 337
- 0
A Study on the Effects of Argentine Tango as a Form of Partnered Dance for those with Parkinson Disease and the Healthy Elderly pptx
... group stated on the exit questionnaire what they liked best and least about the program They greatly appreciated the camaraderie and socialization engendered by the program Being able to meet others ... for their assistance with this study This work was supported by a grant from the Marian Chace Foundation to Madeleine Hackney and a grant from the American Parkinson Disease Association to Gammon ... Reach The control tango group experienced gains in One Leg Stance, and remained the same in Functional Reach, and Activities Balance Confidence (Table 3, Figs and 2) Attendance/Participation All...
- 19
- 648
- 0
báo cáo hóa học: " Shedding light on walking in the dark: the effects of reduced lighting on the gait of older adults with a higher-level gait disorder and controls" ppt
... Santos LC, Patla AE: Contribution of vision and cutaneous sensation to the control of centre of mass (COM) during gait termination Brain Res 2001, 913:27-34 Nakamura T: Quantitative analysis of ... variability A small perturbation could then take an already unstable system and cause a fall Regardless of the precise explanation, the present results highlight the inappropriate response of ... repeated measures For each gait parameter, a separate model was applied The dependent variable was the gait parameter and the independent variables were the group (patients or controls), the walking...
- 8
- 415
- 0
Báo cáo toán học: "On the number of independent sets in a tree" pdf
... 0, j The number of matchings in a tree In this section, we turn to the number of matchings in a graph This is also known as the Hosoya index, or the Z-index in mathematical chemistry For a rooted ... = (ad, ac + bd) ∈ B By 1, if (c, d) ∈ B, then (1, 1) ⊙ (c, d) = (d, c + d) ∈ B (Note that attaching a new vertex to the root has exactly the same effect as in the proof of Proposition 4.) Consider ... that (k, a) ∈ B Repeating the argument by increasing k, we conclude that B = Z2 m the electronic journal of combinatorics 17 (2010), #N18 References [1] S .A Burr, On moduli for which the Fibonacci...
- 5
- 263
- 0
báo cáo khoa học: " Using the theory of planned behaviour as a process evaluation tool in randomised trials of knowledge translation strategies: A case study from UK primary care" pot
... doctor, a score for each construct in the TPB model was calculated as the mean of all items contributing to the construct Cronbach’s alpha was used to ascertain the reliability of each of the scales ... of the relationship between intention and behaviour, because the behaviour data were at a practice level, a summary measure of intention for each practice had to be calculated This was generated ... this article as: Ramsay et al.: Using the theory of planned behaviour as a process evaluation tool in randomised trials of knowledge translation strategies: A case study from UK primary care Implementation...
- 9
- 367
- 0
Báo cáo khoa hoc:" Drug-induced hepatitis superimposed on the presence of anti-SLA antibody: a case report" potx
... Journal of Medical Case Reports 2008, 2:25 ble liver antigens (anti-SLA) helps in the identification of ANA/SMA-negative patients Type AIH (AIH-2) is characterized by the presence of autoantibodies ... and herbal medicines (Centaurea Aspera L and Coutarea latiflora DC) for hypoglycaemia (self-medicated) Physical examination showed moderate mucocutaneous jaundice without stigmata of chronic liver ... loss of 10 kg and mild epigastric and right upper quadrant abdominal Withdrawal of the medication resulted in normalization of liver function within weeks and according to the AASLD practice guidelines...
- 4
- 281
- 0
Báo cáo y học: "Clinical importance and impact on the households of oseltamivir-resistant seasonal A/H1N1 influenza virus in healthy children in Italy" ppt
... (0.05 μM); A/ H3-forward CCTTTTTG TTGAACGCA-GCAA (1 μM); A/ H3-reverse CGGATGAGGCAACTAGTGACCTA (1 μM); A/ H3-probe VICCCTACAGC-AACTGTTACCMG BNFQ (0.25 μM); B-forward TCACGAAAAATACGGT GGATTAAA (0.75 ... BIOTIN-CCACGTTTTGATTAAAAGACACC; N1 275-sequence AGTTGAATGCACCCAAT; N1 294sequence TGTGTGTATGCAGGGAC; N2 119-forward TTTTATCTGACCAACACCACCATAGAG; N2 119reverse BIOTIN-CGCTAAGGGGTCCTATCATGTACT; N2 119-sequence ... (Bari); Paolo Siani (Napoli); Ilaria Sala and Maria Cristina Diana (Genova) for their contribution to study enrolment, and Shahjahan Miah for his technical assistance 14 Author details Department of...
- 4
- 307
- 0
Báo cáo y học: "The Nordic Maintenance Care Program – An interview study on the use of maintenance care in a selected group of Danish chiropractors" pdf
... would vary with the needs of the patient Duration of maintenance care program Aim of the maintenance care program Ten of the eleven chiropractors agreed that the main purpose of maintenance care ... under A- F An additional, "neither of the above, please explain"alternative was also available (G), with the possibility to provide ones own alternative answer (Additional file 2) Page of (page number ... remain in a maintenance care program The results revealed that there was fair agreement among the participants on the choice of management strategies, notably for scenarios that indicated the need...
- 7
- 420
- 0
A study on the bennefits of using portfolios as a means of assessment in the writing development for the third year stdents of english at hanoi pedagogical university no 2
... importance Additionally, the approach encourages content information and personal expression rather than final product grammar and usage (cited in Nguyen, 2007) II.3.2 Formative and Summative assessment ... i ABSTRACT Since the application of Communicative Language Teaching approach to EFL teaching, process writing and collaborative learning have been greatly emphasized as typical features of teaching ... research questions are also clearly stated to act the parameter for the whole paper I.1 RATIONALE A vast body of research has studied writing portfolios as a form of assessment tool or in terms of...
- 65
- 893
- 7
On the conformation of DNA confined in a nanochannel or absorbed at an interface
... in the DNA attraction DNA binding is then dependent on the fractional surface densities of the divalent and monovalent cations, which can compete for the mica surface and DNA neutralizations ... extra factors such as the fraction of dissociated ionic groups, the charge valency of these groups, the dielectric constant of the solution, and the concentration of counterions 20 and salt ions ... experimental strategy for the study of the depletion effect on large DNA chains exerted by nanoparticles A clear phase diagram is observed as a function of the nanoparticle concentration In nanochannels...
- 153
- 465
- 0
Analysis on the growth of bribery in china a preliminary study
... collapse of CCP’s ruling position Jiang Zemin, at the 15th National Congress of the Communist Party of China, stated that corruption is a problem of the life and death of the party and the state ... administrative regulations and found out a high standard of conduct of the state and party officials This high standard of conduct is in accordance to the Chinese traditional social norm that public officials ... reassessment The existing literature has paid much attention to the nature and extent of corruption, yet there is a relative absence of analysis on the trend of corruption in China and major factors that...
- 109
- 463
- 0
The theory of financial intermediation: An essay on what it does (not) explain
... seen as a form of market imperfection The mainstream theory of the firm evolved under the paradigm of the agency theory and the transaction costs theory as a theory of economic organization rather ... liberalized, deregulated financial markets All information on important macroeconomic and monetary data and on the quality and activities of market participants is available in ‘real time’, on a ... 41 A New Research Agenda Would the amended theory of financial intermediation lead to a new research agenda? Partly Battacharya and Thakor have listed what they regard as the key questions and...
- 59
- 1,656
- 0
A CFD analysis on the effect of ambient conditions on the hygro-thermal stresses distribution in a planar ambient airbreathing PEM fuel cell
... membrane hydration and avoidance of water flooding in the cathode catalyst layer and/or gas diffusion layer [2] Water management is related with air supply to the cathode and is one of the crucial ... solving the steady-state Navier-Stokes equations, i.e the continuity equation, the mass conservation equation for each phase yields the volume fraction (r ) and along with the momentum equations the ... both gas and liquid phase in the same computational domain, and thus allows for the implementation of phase change inside the gas diffusion layers The model includes the transport of gaseous species, ...
- 16
- 727
- 0
Tài liệu THE THEORY OF MONEY AND CREDIT - New edition, enlarged with an essay on Monetary Reconstruction docx
... Inflation and Deflation 239 CHAPTER VIII § §2 §3 § 4- §5 MONETARY POLICY THE MONETARY POLICY OF ETATISM The Monetary Theory of Etatism National Prestige and the Rate of Exchange The Regulation of ... established tradition of arrangement, but even of a single example of a systematic treatment of the subject on a scale and of a quality comparable with that of the standard discussions of the central problems ... because our means are limited, the situation is often such that the alternatives are on the one hand one big satisfaction and on the other hand a large number of homogeneous smaller satisfactions...
- 500
- 2,297
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008