distribution 2 a poisson process with varying rate parameter and the gamma density
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx
... GCGGGATCCCGTTTCCCAGCCTGTTGGGCCT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC ... GCGGGATCCGTGAATAATCTGCACCCTCGA ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC ... ATAAGAATGCGGCCGCTCAGGGCTGCGTGGTCACAGAGGC GCGGGATCCCGCAGGGTGAACTCTGCCTCC ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT GCGGGATCCCCCCCTGCCGAAGTGGACCCT ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT...
- 14
- 517
- 0
Monetary Policy in the Eurozone: Evaluating the European Central Bank’s interest rate decisions and the needs of member states using a Taylor rule ppt
... would also be a positive 82 Bergsten and Kirkegaard 20 12 Bergsten and Kirkegaard 20 12 84 De Grauwe 20 02 85 Kirkegaard 20 11 86 Bergsten and Kirkegaard 20 12 87 Bergsten and Kirkegaard 20 12 88 Shambaugh ... Grauwe 20 02 Lee and Crowley 22 Srivangipuram 24 rates and output These filters are also inappropriate from a conceptual perspective As Muscatelli, Tirelli, and Trecroci (20 02) point out, they are ... countries in the monetary union, Fernanda Nechio groups Italy with the core countries (Austria, Belgium, France, Finland, Germany, and the Netherlands) as “its inflation rate and unemployment gap are...
- 41
- 513
- 0
Báo cáo hóa học: " A Receiver for Differential Space-Time π/2-Shifted BPSK Modulation Based on Scalar-MSDD and the EM Algorithm" ppt
... independent Gaussian random variables, with a variance of Similarly, it can also be shown that the new noise samples w1 [k] and w2 [k] are independent and have variance 2N0 These results mean that the ... data consists of the desired data and the nuisance data In the context of the problem at hand, the complete set of data is the (equivalent) transmitted pattern B and the channel gains g1 and g2 ... by Tarasak and Bhargava in a transmit-diversity only scenario [14], and by Lao and Haimovich in an interference suppression and receive-diversity setting [15] In addition, Tarasak and Bhargava...
- 9
- 258
- 0
Báo cáo y học: "Self-rated health showed a consistent association with serum HDL-cholesterol in the cross-sectional Oslo Health Study" pptx
... diseases may be causally related to the serum lipids, such as, diabetes 2, and cardiovascular diseases [22 ,23 ] In accordance with this, the HDL-C concentration was lower in subjects with, than without, ... Middle-aged 2, 18 1,58 3, 02 Middle-aged 2, 88 2, 27 3,65 Senior 2, 02 1,49 2, 75 Senior 2, 10 1,69 2, 62 Old 1,94 0,96 3,94 Old 1, 62 1,31 2, 00 Young 4, 92 2,61 9 ,26 Young 3, 72 2,56 5,41 Middle-aged 2, 22 1, 62 ... suggesting only a minor influence on the positive association between SRH and HDL-C In the bivariate analyses of the present material there was a moderate positive association between SRH and intake frequency...
- 10
- 347
- 0
Báo cáo y học: "Successful surgical resection of infected left atrial myxoma in a case complicated with disseminated intravascular coagulation and multiple cerebral infarctions: case report" ppt
... postoperative day The antibiotic therapy with ampicillin was totally administered for six weeks Histological examination showed that the mass was an infected atrial myxoma, and gram staining of the ... (allow) with the red thrombus and vegetation (*) (B): Hematoxylin and eosin (HE) and showed that the mass was an atrial myxoma, and gram staining of the infected portion revealed the presence of gram-positive ... tumor was completely excised with the attached atrial septum via a trans-septal approach A small amount of vegetation was observed in the posterior mitral chordae, which was carefully excised without...
- 4
- 543
- 0
báo cáo khoa học: " Drug Checking: A prevention measure for a heterogeneous group with high consumption frequency and polydrug use - evaluation of zurich’s drug checking services" potx
... to 20 09, which decreased on average by 13.0% and/ or cannabis Nineteen percent of the evaluated sample consumed cocaine together with ecstasy, and 22 .2% consumed ecstasy together with amphetamines ... the evaluated sample population increased for alcohol, cannabis and cocaine (20 04: 37 .2% 11.6% and 10.1%, respectively; 20 09: 43.0%, 16.8% and 11.5%, respectively) and decreased for ecstasy and ... ( 92. 7%), cocaine (80.8%) and/ or amphetamines (74.8%) at least once in their life As shown in Figure 1, the initiation age for legal substances (alcohol and tobacco) was approximately 15 and the...
- 6
- 267
- 0
Báo cáo y học: "HTLV-1 in rural Guinea-Bissau: prevalence, incidence and a continued association with HIV between 1990 and 2007" doc
... CTTRACAAACATGGGGAGGAAAT mo 013 B2M OF TAGAGGTTCCCAGGCCACTA mo 014 B2M OR ACCATGTAGCCTATGCGTGT mo 015 B2M IF ACAAGGAGCTCCAGAAGCAA mo 016 B2M IR CAGAACATGTCCCCGTCATT van Tienen et al Retrovirology 20 10, ... statistical advice and insightful comments Author Details 1Medical Research Council, Fajara, The Gambia, 2Municipal Health Service and Academic Medical Centre, Amsterdam, The Netherlands, 3Department ... have enabled the spread of HIV -2 [ 32, 33] A concomitant iatrogenic spread through vaccination campaigns and large-scale parenteral treatment programs might have also contributed to the initial...
- 9
- 336
- 0
Báo cáo y học: "Clinical review: A review and analysis of heart rate variability and the diagnosis and prognosis of infection" pps
... reduced adaptability associated with a stressed physiologic state and/ or activation of the sympathetic response Nonetheless, alteration of variability offers a clinically useful and quantifiable measure ... JD: The Procalcitonin And Survival Study (PASS) - a randomised multi-center investigator-initiated trial Page of (page number not for citation purposes) 19 20 21 22 23 24 25 26 27 28 29 30 31 32 ... conclusion was that neonatal heart rate data are predominantly nonstationary and that they become more nonstationary in the early course of sepsis The elements of HRC consist of various statistics and...
- 7
- 246
- 0
A Poisson bridge between fractional Brownian motion and stable Levy motion
... to a compensated Poisson random measure We start by recalling some facts about Poisson random measures 2. 1 Poisson random measures and integrals A recent comprehensive account on Poisson random ... Math Soc (2) , 67(3):657–6 72 16 Gaigalas, R and Kaj, I (20 03) Convergence of scaled renewal processes and a packet arrival model Bernoulli, 9(4):671–703 Kaj, I (20 05) Limiting fractal random processes ... et al., 20 03; Gaigalas and Kaj, 20 03, and references therein): fractional Brownian motion, stable L´evy motion and the process Yα (t) Integral representations can serve as a unified framework...
- 17
- 406
- 0
Đề tài " Projective structures with degenerate holonomy and the Bers density conjecture " potx
... define an equivalence relation between points on A+ and A and between A and A+ Namely, if p1 ∈ A+ and p2 ∈ A then Z Z Z p1 ∼ p2 if they are mapped to the same point by the isometry to A Similarly ... points outward and A the copy of A where the normal points inward Similarly label the two copies of A in the boundary of MZ − AZ , A+ and A All four of these annuli are isometric to A Z Z and we ... and Y Then M can be conformally compactified by viewing X and Y as conformal structures on S × {−1} and S × {1}, *This work was partially supported by grants from the NSF and the Clay Mathematics...
- 18
- 358
- 0
OccasiOnal Pa Per series nO 109 / a Pril 2010: EURO area Fiscal POlicies and The crisis pot
... 19 January 20 09 21 January 20 09 AA+ AA ABBB+ AA+ A+ Negative Stable Negative Stable Stable Source: Standard and Poor’s 38 ECB Occasional Paper No 109 April 20 10 risk, investors seem to have taken ... of GDP in 20 15, 120 % in 20 20 and 150% in 20 26 50 -2 -2 -4 -4 -6 -6 -8 -8 -10 -10 - 12 - 12 2008 20 28 Source: ECB calculations ECB Occasional Paper No 109 April 20 10 20 12 2016 20 20 20 24 20 28 Source: ... empirical investigation by Maria Grazia Attinasi, Cristina Checherita and Christiane Nickel 40 ECB Occasional Paper No 109 April 20 10 Box Measuring fiscal sustainability by Maria Grazia Attinasi, Nadine...
- 81
- 1,376
- 0
Bank of England Interest Rate Announcements and the Foreign Exchange Market ∗ doc
... significant shifts in the mean μ, the autocorrelation coefficient ρ, and the variance σ Recall that state is the high-variance state associated with informationbased trading and state is the low-variance ... is the change in the logarithm of the exchange rate at time t The mean of the exchange rate returns process, μ, the autocorrelation coefficient, ρ, and the variance of the innovation, εt , are allowed ... terms of the repurchase, or repo, rate and after that date in terms of the Bank rate We use the two names interchangeably Vol No Bank of England Interest Rate Announcements 21 3 analyses, we allow...
- 37
- 562
- 0
WORKING PAPER NO. 218 THE ZERO-INTEREST-RATE BOUND AND THE ROLE OF THE EXCHANGE RATE FOR MONETARY POLICY IN JAPAN potx
... increase and the ex-ante long-term real interest rate falls slightly rather than increases as in the benchmark scenario and the recession and deflation are signficantly dampened The exchange rate ... economics with heterogenous agents” by S Honkapohja and K Mitra, January 20 02 121 “Natural rate doubts” by A Beyer and R E A Farmer, February 20 02 122 “New technologies and productivity growth in the ... rate; i : short-term nominal interest rate; π (4) : annual inflation; π ∗ : inflation target; e: bilateral real exchange rate and is scaled with the parameter σ d The long-term real interest rate...
- 53
- 586
- 0
Building Enterprise Applications with Windows Presentation Foundation and the Model View ViewModel Pattern doc
... application (UI, business logic, and database), you usually have two/three layers per tier and two tiers The tiers are the client application and the remote database (physically separated), and ... charge of encapsulating all the business logic of the application; and a Data Access Layer, the layer in charge of persisting and retrieving data All programming paradigms aid developers in the ... application UIs The Menubar The Menubar is the menu at the top of any application It is the topmost container, and it should contain all the available commands in the application, divided into related...
- 225
- 2,476
- 0
Báo cáo khoa học: "Discriminative Language Modeling with Conditional Random Fields and the Perceptron Algorithm" pptx
... and the algorithm moves to the next utterance After each pass over the training data, performance on a held-out data set is evaluated, and the parameterization with the best performance on the ... Say αi is the ¯t parameter vector after the i’th example is processed on the t’th pass through the data in the algorithm in figure Then the averaged parameters αAV G are defined ¯ as αAV G = i,t ... Conditional Random Fields have been applied to NLP tasks such as parsing (Ratnaparkhi et al., 1994; Johnson et al., 1999), and tagging or segmentation tasks (Lafferty et al., 20 01; Sha and Pereira, 20 03;...
- 8
- 458
- 0
Báo cáo khóa học: Interaction between the 2¢)5¢ oligoadenylate synthetase-like protein p59 OASL and the transcriptional repressor methyl CpG-binding protein 1 potx
... controls (a) an empty bait vector and a bait vector containing the unrelated Fhit cDNA as general negative controls and (b) a bait vector containing the p 42 OAS cDNA that addressed the interaction with ... the interaction between LexA–p59.4 OASL protein and prey MBD1–GAL4AD (A) The L40 yeast strain was transformed with the indicated baits and preys and assayed on double and triple selection plates ... double-stranded RNA, and RNA degradation Isolation and characterization of homogeneous human (2 )5¢) (a) n synthetase J Biol Chem 25 6, 9 324 –9 328 Dong, B & Silverman, R.H (1995) 2 5A- dependent RNase...
- 9
- 419
- 0
a theory of political obligation membership commitment and the bonds of society jul 2006
... offices in Argentina Austria Brazil Chile Czech Republic France Greece Guatemala Hungary Italy Japan Poland Portugal Singapore South Korea Switzerland Thailand Turkey Ukraine Vietnam Oxford is a registered ... 43 2. 1 2. 2 2. 3 2. 4 3.1 Desiderata for a theory of political obligation 3 .2 Some less than promising notions of membership Actual Contract Theory: Attractions 4.1 Actual contract theory 4 .2 Analytic ... standard objections At the same time people often allow that aspects of the theory make it particularly attractive as a solution to the membership problem I explain these and review the two standard...
- 343
- 431
- 0
báo cáo hóa học:" Global exponential synchronization of delayed BAM neural networks with reaction-diffusion terms and the Neumann boundary conditions" docx
... participated in the design of the study and suggest many good ideas that made this paper possible and helped to draft the first manuscript All authors read and approved the final manuscript Acknowledgments ... University, Shaan Xi Xi’an 710071, P.R China Institute of Maths and Applied Mathematics, Xianyang Normal University, Xianyang, ShaanXi 7 120 00, P.R China * Corresponding author: ahzwy@163.com Email address: ... 22 = 0.1, ρ11 = 0.6, ρ 12 = 2, ρ 21 = 1, ρ 22 = 0.4 By simple calculation with w1 = w2 = w3 = w4 = 1, β11 = β 12 = β 21 = β 22 = 1, and γ 11 = γ 12 = γ 21 = γ 22 = , we get 2 j =1 r j =1 −rna1r...
- 28
- 451
- 0
ODP.NET Developer''''s Guide: Oracle Database 10g Development with Visual Studio 2005 and the Oracle Data Provider for .NET pot
... DataTable Using OracleDataReader Retrieving a Single Row of Information Using OracleDataAdapter Working with DataTableReader Populating a Dataset with a Single Data Table Populating a Dataset ... Using Array Binding Creating an Oracle Table Dynamically Using ODP.NET Updating Offline Data to the Database Using OracleDataAdapter Working with OracleCommandBuilder and OracleDataAdapter ... several methods to retrieve data from an Oracle database You will work with the core ODP.NET classes like OracleCommand, OracleDataReader, OracleDataAdapter, OracleParameter, and ADO.NET classes...
- 326
- 626
- 1
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25