display 4 1 formal parameter used as a local variable 3 of 3

Báo cáo hóa học: " Could sound be used as a strategy for reducing symptoms of perceived motion sickness?" docx

... ratings of motion sickness as often as possible, it is always a trade-off between asking many or few questions to obtain a valid measurement of the perceived state The NoFix slope increased as ... 2 .46 0.27 -0 .11 to 0.65 Horizon 1. 77 1. 07 to 2 .47 Non-pos 0.79 0 . 41 to 1. 17 0.00 -0 .44 to 0 .45 Horizon 0. 74 0 .33 to 1. 15 Non-pos 0.76 0 .46 to 1. 07 0 .17 -0.09 to 0 . 43 Horizon 0.57 0 .33 to 0. 81 ... the variation in ST was large, and hence approximately half of the subjects terminated the tests before 50% of the maximum time had passed Outcome data were analysed using a slope calculated as...

9
609
0

Báo cáo toán học: " Music expression with a robot manipulator used as a bidirectional tangible interface" pptx

Danh mục: Toán học

... virtual dynamical systems in task space [9] For example, the robot can move towards a virtual attractor in 3D Cartesian space as if its dynamics was equivalent to a virtual mass concentrated ... Kong, China, pp 30 8- 31 1 (19 96) 15 C Cadoz, L Lisowski, J Florens, A modular feedback keyboard design Comput Music J 14 , 47 – 51 (19 90) 16 N Castagne, C Cadoz, J Florens, A Luciani, Haptics in computer ... Musical-based interaction system for the Waseda Flutist Robot Autonomous Robots 28 (4) , 47 1 48 8 (2 010 ) A Kapur, M Darling, A Pedagogical Paradigm for Musical Robotics, in Proceedings of the 2 010 ...

34
323
0

báo cáo hóa học:" Music expression with a robot manipulator used as a bidirectional tangible interface" potx

Danh mục: Hóa học - Dầu khí

... virtual dynamical systems in task space [9] For example, the robot can move towards a virtual attractor in 3D Cartesian space as if its dynamics was equivalent to a virtual mass concentrated ... Kong, China, pp 30 8- 31 1 (19 96) 15 C Cadoz, L Lisowski, J Florens, A modular feedback keyboard design Comput Music J 14 , 47 – 51 (19 90) 16 N Castagne, C Cadoz, J Florens, A Luciani, Haptics in computer ... Musical-based interaction system for the Waseda Flutist Robot Autonomous Robots 28 (4) , 47 1 48 8 (2 010 ) A Kapur, M Darling, A Pedagogical Paradigm for Musical Robotics, in Proceedings of the 2 010 ...

34
183
0

Báo cáo toán học: "The number of 0-1-2 increasing trees as two diﬀerent evaluations of the Tutte polynomial of a complete graph" potx

Danh mục: Báo cáo khoa học

... Combinatorial Theory Ser A, 18 , 14 1 – 14 8 , 19 75 [4] Foata, D.: Groupes de r´arrangements et nombres d’Euler C R Acad Sci Paris e Sr A- B, 275, A1 14 7 A 115 0, 19 72 [5] Foata, D and Strehl, V.: Rearrangements ... Chichester 19 83 [7] Kuznetsov, A G., Pak, I M and Postnikov, A E.: Increasing trees and alternating permutations (Russian) Uspekhi Mat Nauk, 49 , 79 11 0, 19 94; translation in Russian Math Surveys, 49 , ... polynomial and increasing trees A spanning tree in Kn with root at is said to be increasing whenever its vertices increase along the paths away from the root A 0 1 2 increasing tree is an increasing...

5
319
0

Báo cáo y học: "Can HRCT be used as a marker of airway remodelling in children with difficult asthma?" docx

Danh mục: Báo cáo khoa học

... (NIH image 1. 55; National Institute of Health, Bethesda, MD) as previously described [ 13 ] Briefly, at a magnification of 40 0, at least 40 measurements of RBM thickness were made 20 µm apart A minimum ... bronchial diameters Magnified area of an axial HRCT of a child with difficult asthma showing a circular bronchus that was quantified 1a) outer (Do = 0.5 cm) and 1b) inner (Di = 0 .3 cm) bronchial diameters ... bronchiectasis and lung function [16 ] Bronchial dilatation was not assessed The mean of the two scores ascribed was used to assess the relationship between BWT and RBM thickness and FEV1 Page of (page...

9
390
0

phân tích 1 tấn công của hacker ( bsì 3)

Danh mục: Tin học

... [1: 1 248 : 13 ] WEB-FRONTPAGE rad fp30reg.dll access [**] [Classification: access to a potentially vulnerable web application] [Priority: 2]08/09 -15 :39 : 23. 000000 19 2 .16 8 .11 1 .17 : 14 5 4 -> 19 2 .16 8 .11 1. 23: 80 ... gói 15 : 04: 51. 546 875 IP (tos 0x0, ttl 12 8, id 9588, offset 0, flags [DF], proto: TCP (6), length: 51) 19 2 .16 8 .11 1 .17 .1 34 7 > 19 2 .16 8 .11 1. 23. 80: P, cksum 0x5b06 (correct), 33 8 946 2 932 :33 8 946 2 9 43 (11 ) ... 33 8 946 2 932 :33 8 946 2 9 43 (11 ) ack 2975555 611 win 642 40 0x0000: 45 00 0 033 25 74 4000 8006 75d7 c 0a8 6f 11 E 3% t@ u o 0x0 010 : c 0a8 6f17 0 5 43 0050 ca07 19 94 b15b 601b o C.P [` 0x0020: 5 018 faf0 5b06 0000 47 45 542 0 736 c 736 c...

3
421
0

báo cáo hóa học:" Aberrant expression and potency as a cancer immunotherapy target of alpha-methylacyl-coenzyme A racemase in prostate cancer" pptx

Danh mục: Hóa học - Dầu khí

... 14 15 60 73 65 64 67 67 71 71 72 67 67 61 61 61 60 6.7 6.0 11 .6 15 .6 18 .4 14 . 4 10 .9 4. 6 5.7 8.0 4. 3 11 .5 10 .1 10 .4 6.6 4+ 3 3 +3 4+ 3 3 +4 4+5 4+ 3 3+5 3 +4 3 +4 4 +4 3+ 3 3 +4 4 +3 3 +4 3 +4 Pathologic stage ... 51Crrelease assay LNCaP -A* 240 2 and DU 14 5 -A* 240 2, which express both endogenous AMACR and gene-transfected HLA -A* 240 2, were used as target cells Parental LNCaP and DU 14 5 cells, HLA -A* 240 2-negative ... Page 10 of 11 (page number not for citation purposes) Journal of Translational Medicine 2009, 7 :10 3 10 11 12 13 14 15 16 17 18 19 20 21 22 tide vaccine for the treatment of patients with metastatic...

11
531
0

Báo cáo y học: " Laugh syncope as a rare sub-type of the situational syncopes: a case report" potx

Danh mục: Báo cáo khoa học

... Cardiol 20 01, 37 :19 21- 1928 Bragg MJ: Fall about laughing: a case of laughter syncope Emerg Med Australas 2006, 18 : 518 - 519 Arthur W, Kaye GC: Important points in the clinical evaluation of patients ... etiology One populationbased study found that cardiac and neurologic syncope were associated with an increased risk of death from any cause and an increased risk of cardiovascular events and stroke, ... the investigation that led to the patient's diagnosis and assisted in the formulation of the manuscript All authors read and approved the final manuscript References 10 11 12 13 14 15 Huff JS,...

4
190
0

báo cáo khoa học:" Fanconi anemia manifesting as a squamous cell carcinoma of the hard palate: a case report" pptx

Danh mục: Báo cáo khoa học

... therapy and had not received a bone marrow transplant The haematological test revealed an early stage of pancytopenia (3 ,4 × 10 9/l, Hb 12 ,3 g/dl, and platelets 13 × 10 9/l) Oral examination revealed ... advances Stem Cells 19 94, 12 : 14 2 -15 3 Linares M, Pastor E, Gomez A, Grau E: Hepatocellular carcinoma and squamous cell carcinoma in a patient with Fanconi's anemia Ann Hematol 19 91, 63: 54- 55 LeBrun DP, ... International Fanconi Anaemia Registry (3% ) had HNSCC [11 ] In the same year Bremer presented two cases of HNSCC [15 ], but in international literature no article has reported a hard palate localization...

5
245
0

Báo cáo y học: " Vascular endothelial growth factor as a non-invasive marker of pulmonary vascular remodeling in patients with bronchitis-type of COPD" pot

Danh mục: Báo cáo khoa học

... expression of vascular endothelial growth factor and vascular endothelial growth factor receptor in emphysema Am J Respir Crit Care Med 20 01, 16 3: 737 -44 Kanazawa H, Asai K, Hirata K, Yoshikawa J: Possible ... acquisition of data, analysis and interpretation of data, and drafting of the manuscript KA participated in the analysis and interpretation of data, technical support, and critical revision of ... effects of vascular endothelial growth factor in the pathogenesis of chronic obstructive pulmonary disease Am J Med 20 03, 1 14 : 3 54- 8 Tatsumi K, Kasahara Y, Kurosu K, Tanabe N, Takiguchi Y, Kuriyama...

7
257
0

Identification and characterization of protein kinase CK2 as a novel interacting protein of neuronal CDK5 kinase and its functional role in microtubule dynamics

Danh mục: Cao đẳng - Đại học

... localization 1. 1.2 Regulation of CK2 1. 1 .3 Biological effects of CK2 13 1. 1 .3 .1 Regulation of adhesive proteins 13 1. 1 .3. 2 Regulation of cytoskeletal elements 14 1. 1 .3. 3 Regulation of substrates ... 1. 3. 2.2 Cdk5 in synapses and focal adhesion sites 31 1 .3. 2 .3 Cdk5 in neurosignaling 33 III 1. 3. 2 .4 Cdk5 in transcriptional machineries 34 1. 3. 3 36 Molecular organization of Cdk5 complexes 1. 3. 3 .1 ... 1. 3. 3 .1 Methods used in isolating protein-interacting partners 38 1 .4 Microtubule Dynamics 40 Materials and Methods 46 2 .1 Materials 47 2 .1. 1 Chemicals and reagents 47 2 .1. 2 Cell lines 48 2 .1. 3 Antibodies...

182
480
0

Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"

Danh mục: Y học thưởng thức

... (sense, 5’-AAGGAGGCACTGGGAGAGGGGAAAT -3 (bases - 13 23 to -12 99) and antisense, 5’CCCCACCAAGCCAACACAGGATGGA -3 (bases - 919 to-895) were used to amplify a 42 9-bp product from genomic DNA (Fig 1A) The ... AAGGAGGCACTGGGAGAGGGGAAAT -3 (bases - 13 23 to -12 99 from the major transcriptional initiation site) and antisense, 5’-AATTAGCTGGGCATGGTGGCAGGCG -3 (bases -10 75 to -10 51) ) that recognize part of the ... 20 04; 17 : 1 045 -9 15 1 11 Sano M, Kuroi N, Nakayama T, et al The association study of calcitonin-receptor-like receptor gene in essential hypertension Am J Hypertens 2005; 18 : 40 3- 8 12 Nakayama...

7
612
1

Lab 4.1.4 Creating a Network Map using CDP

Danh mục: Quản trị mạng

... prompted for a password, enter class If “class” does not work, ask the instructor for assistance Router>enable At the privileged EXEC mode, enter the command erase startup-config Router#erase startup-config ... Interface #2 Interface #1 Interface #2 #5 800 (806) Ethernet (E0) Ethernet (E1) 16 00 Ethernet (E0) Ethernet (E1) Serial (S0) Serial (S1) 17 00 FastEthernet (FA0) FastEthernet (FA1) Serial (S0) Serial ... performed 3 -4 CCNA 2: Routers and Routing Basics v 3. 0 - Lab 4. 1 .4 Copyright  20 03, Cisco Systems, Inc Router Interface Summary Router Ethernet Ethernet Serial Serial Interface Model Interface #1 Interface...

4
505
0

Tài liệu Module 4: DNS as a Solution for Name Resolution docx

Danh mục: Hệ điều hành

... databases increases as well Similarly, as the DNS zone database size increases, the length of time to resolve DNS queries increases Delegated zones divide a DNS zone database into smaller parts, ... as a traditional primary zone from another BIND-based DNS server To a BIND-based DNS server, Active Directory integrated zones appear as traditional primary zones You can replicate to other Active ... profile Each location has a dedicated T1 or T3 connection to the Internet The market research analysts use a Web-based application for call tracking and recording of consumer responses The organizations...

60
373
0

Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc

Danh mục: Báo cáo khoa học

... Petersburg, FL, USA) followed by PCR with Taq DNA polymerase (Promega, Madison, WT, USA) using the primers 5¢-CACACTACACTGGGAAGCAGAGACTCCAGC -3 and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG3¢ The cDNA was subcloned ... palmitoylation of Shh 40 41 42 43 44 45 46 47 48 49 interactions by steric interference J Biol Chem 275, 10 995 11 0 01 Tanaka Hall TM, Porter JA, Beachy PA & Leahy DJ (19 95) A potential catalytic ... homolog of the Drosophila segment FEBS Journal 275 (2008) 31 8 3 31 ª 2007 The Authors Journal compilation ª 2007 FEBS 32 9 A negative regulator for palmitoylation of Shh 10 11 12 13 14 15 16 33 0 Y Abe...

14
499
0

Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx

Danh mục: Báo cáo khoa học

... Proc Natl Acad Sci USA 94, 10 172 10 177 12 Malakauskas, S.M & Mayo, S.L (19 98) Design, structure and stability of a hyperthermophilic protein variant Nat Struct Biol 5, 47 0 47 5 13 Ross, S .A. , Sarisky, ... association of the variable heavy chain (VH) with protein A was used as a surrogate for direct stability measurements The VH domains in camelid heavy chain antibodies are most similar to the classical ... 2 34 5 – 235 3 29 Merkel, J.S., Sturtevant, J.M & Regan, L (19 99) Sidechain interactions in parallel b-sheets: The energetics of cross-strand pairings Structure 7, 13 33 1 34 3 30 Lassila, K.S., Datta, D...

7
502
0

Tài liệu Module 4: Configuring ISA Server as a Firewall ppt

Danh mục: Quản trị mạng

... 20 04 as a Firewall What Is a TCP/IP Packet? Network Interface Layer Internet Layer Transport Layer Application Layer Destination Address: 0003FFD329B0 Source Address: 0003FFFDFFFF Physical payload ... 0003FFFDFFFF Physical payload Destination: 19 2 .16 8 .1. 1 Source: 19 2 .16 8 .1. 10 Protocol: TCP IP payload Destination Port: 80 Source Port: 11 59 Sequence: 38 37066872 Acknowledgment: 298 247 0625 HTTP Request ... What Is System Policy? System policy is: A default set of access rules applied to the ISA Server to enable management of the server A set of predefined rules that you can enable or disable as...

31
470
0

Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

Danh mục: Báo cáo khoa học

... SRp40 hnRNP A1 , hnRNP E1 ⁄ E2 hnRNP A1 ASF ⁄ SF2 hnRNP A1 UUAGGACAUAUAGUUAGCCCUAGG unknown UGGGU CUAGACUAGA CCAGUAGAUCCUAGACUAGA GAAGAAGCGGAGACAGCGACGAAGA AGAUCCAUUCGAUUAG unknown UAGUGAAUAGAGUUAGGCAGGGA ... UAGUGAAUAGAGUUAGGCAGGGA GAAGAAGAA UAGAAGAAGAA 49 95–5 017 [5, 12 , 38 , 40 ] 536 2– 536 6 542 8– 5 43 7 5 41 8– 5 43 7 5558–5582 8 047 –8062 [48 , 41 , 15 , 17 , 8] A3 A5 A7 ISS ESE3 The HIV -1 encoded proteins Tat, which acts as ... nuclear localization of viral nucleic acids in nondividing host cells Proc Natl Acad Sci USA 91, 7 31 1 –7 31 5 32 Kamata M, Nitahara-Kasahara Y, Miyamoto Y, Yoneda Y & Aida Y (2005) Importin-alpha promotes...

10
434
0

Báo cáo khoa học: Post-ischemic brain damage: targeting PARP-1 within the ischemic neurovascular units as a realistic avenue to stroke treatment pptx

Danh mục: Báo cáo khoa học

... 26, 847 –855 33 Gursoy-Ozdemir Y, Can A & Dalkara T (20 04) Reperfusion-induced oxidative ⁄ nitrative injury to neurovascular unit after focal cerebral ischemia Stroke 35 , 14 4 9– 14 5 3 34 Abdallah Y, ... Effect of 3- aminobenzamide, PARP inhibitor, on matrix metalloproteinase-9 level in plasma and brain of ischemic stroke model Toxicology 2 14 , 13 1 13 9 41 Lenzser G, Kis B, Snipes JA, Gaspar T, Sandor ... signals Eur J Neurosci 20, 14 6 1 14 7 2 Nakajima H, Nagaso H, Kakui N, Ishikawa M, Hiranuma T & Hoshiko S (20 04) Critical role of the automodiﬁcation of poly(ADP-ribose) polymerase -1 in nuclear factor-kappaB-dependent...

10
417
0

Báo cáo Y học: A catalytically inactive b1,4-N-acetylglucosaminyltransferase III (GnT-III) behaves as a dominant negative GnT-III inhibitor potx

Danh mục: Báo cáo khoa học

... of Asp3 21 and Asp3 23 in the catalysis of GnT-III The absolute requirement for Asp3 21 and Asp3 23 and their conservation in b1,4GalT -1 and snail b1,4GlcNAcT suggest that the short sequence of Asp3 21- Val322-Asp3 23 ... biantennary sugar chain; 2, asialo-agalactobisected tetraantennary sugar chain; 3, asialoagalacto-bisected triantennary sugar chain containing a b1 ,4- GlcNAc residue on the Mana1 ,3 arm Arrowheads ... indicate nonbisected sugar chains: left arrowhead, overlapping peaks of asialo-agalacto biantennary and asialo-agalacto tetraantennary sugar chains; right, asialo, agalacto triantennary sugar chain...

9
352
0