0

display 4 1 formal parameter used as a local variable 2 of 3

Báo cáo hóa học:

Báo cáo hóa học: " Could sound be used as a strategy for reducing symptoms of perceived motion sickness?" docx

Điện - Điện tử

... Horizon -0 .26 -0.78 to 0 .26 Non-pos 2 .45 0.79 to 4. 11 2 .16 -0 .48 to 4. 80 Horizon -0. 02 -1. 50 to1 .45 Non-pos 48 2 . 12 15 1 .36 to 8 12 .88 5 54. 09 95.59 to 10 12. 58 Horizon -76.56 - 32 7 .59 to 1 74. 47 HR (bpm/min) ... 2 .46 0 .27 -0 .11 to 0.65 Horizon 1. 77 1. 07 to 2 .47 Non-pos 0.79 0 . 41 to 1. 17 0.00 -0 .44 to 0 .45 Horizon 0. 74 0 .33 to 1. 15 Non-pos 0.76 0 .46 to 1. 07 0 .17 -0.09 to 0 . 43 Horizon 0.57 0 .33 to 0. 81 ... rate J Neuroeng Rehabil 20 07, 4: 1- 6 McClure JA, Fregly AR: Forehead Sweating during Motion Sickness Pensacola, Florida, USA: Naval Aerospace Medical Research Laboratory; 19 72 :1- 7 27 28 29 30 31 ...
  • 9
  • 609
  • 0
Báo cáo toán học:

Báo cáo toán học: " Music expression with a robot manipulator used as a bidirectional tangible interface" pptx

Toán học

... NJ, USA, 20 08), pp 35 –65 34 SZ Yu, Hidden semi-Markov models Artif Intell 1 74, 21 5 – 24 3 (2 010 ) 35 SZ Yu, H Kobayashi, Practical implementation of an efficient forward–backward algorithm for an explicit-duration ... 20 08), pp 13 71 13 94 24 S Schaal, P Mohajerian, AJ Ijspeert Dynamics systems vs optimal control a unifying view Progress Brain Res 16 5, 42 5 44 5 (20 07) 25 AJ Ijspeert, J Nakanishi, S Schaal, Movement ... virtual dynamical systems in task space [9] For example, the robot can move towards a virtual attractor in 3D Cartesian space as if its dynamics was equivalent to a virtual mass concentrated...
  • 34
  • 323
  • 0
báo cáo hóa học:

báo cáo hóa học:" Music expression with a robot manipulator used as a bidirectional tangible interface" potx

Hóa học - Dầu khí

... NJ, USA, 20 08), pp 35 –65 34 SZ Yu, Hidden semi-Markov models Artif Intell 1 74, 21 5 – 24 3 (2 010 ) 35 SZ Yu, H Kobayashi, Practical implementation of an efficient forward–backward algorithm for an explicit-duration ... 20 08), pp 13 71 13 94 24 S Schaal, P Mohajerian, AJ Ijspeert Dynamics systems vs optimal control a unifying view Progress Brain Res 16 5, 42 5 44 5 (20 07) 25 AJ Ijspeert, J Nakanishi, S Schaal, Movement ... virtual dynamical systems in task space [9] For example, the robot can move towards a virtual attractor in 3D Cartesian space as if its dynamics was equivalent to a virtual mass concentrated...
  • 34
  • 183
  • 0
Báo cáo y học:

Báo cáo y học: "Can HRCT be used as a marker of airway remodelling in children with difficult asthma?" docx

Báo cáo khoa học

... on LABA Number on regular orals steroids 10 .5 (4. 1 – 16 .7) 17 /10 82. 6 ( 32 .1 – 11 8) 21 (78%) 20 00 (800 – 40 00) µm 20 ( 74% ) 50 (18 .5%) * median (range) a – only 23 /27 able to perform satisfactory ... Scheinmann P, Brunelle F: Thoracic CT in pediatric patients with difficult-to-treat asthma AJR Am J Roentgenol 20 02, 17 9 :1 24 5 - 12 52 Kasahara K, Shiba K, Ozawa T, Okuda K, Adachi M: Correlation ... obstruction Am J Respir Crit Care Med 20 05, 17 1: 722 - 727 Standardization of Spirometry, 19 94 Update American Thoracic Society Am J Respir Crit Care Med 19 95, 15 2 :11 07 -11 36 Payne D, McKenzie SA, Stacey...
  • 9
  • 390
  • 0
moving as a child part 2 conversation

moving as a child part 2 conversation

TOEFL - IELTS - TOEIC

... didn’t really think I was hurt at all Kristin: [laugh] Joe: So I have to walk away and, uh, walk home on a broken ankle And, I mean, I just felt like screamin’ at the top of my lungs I was in so ... Moving As A Child Part Conversation knickers: a type of girls pants that not go below the knees back in style: to be fashionable again horrible: very bad playground: a place where children play Kristin: ... can’t imagine It was the worst I, I mean I think for the first two years I lived in Pennsylvania I just wanted to hop on a bus and get back to New York as fast as I could Kristin: Yep, that was me…...
  • 4
  • 416
  • 3
moving as a child part 2 ms

moving as a child part 2 ms

TOEFL - IELTS - TOEIC

... she was She was upset Was it easy to understand that she was upset? Yes, it was pretty obvious that she was upset, which is the same thing as saying it was easy to understand that she was upset ... Yes, it was At first it was rough Was it easy at first? No, it wasn’t easy, it was rough Was it difficult at first? Yes, yes, it was At first it was rough, which is the same thing as saying at first ... nice to Julia Roberts so it was easy to get familiar with them Was it easy to get familiar with them? Yes, it was It was easy to get familiar with them What was easy to do? To get familiar with them,...
  • 21
  • 459
  • 3
moving as a child part 2 pov

moving as a child part 2 pov

TOEFL - IELTS - TOEIC

... nice so it was easy to get familiar with them One day I met a nice man at a café We fell in love and got married When I look back on my wedding I smile and now I think that the fire was a blessing ... I had to move It was pretty obvious that I was upset But I had to leave Los Angeles I moved to a very small town At first it was rough I was the only movie star in town so I stuck out like a sore ... gonna be easy to become familiar with them One day she's gonna meet a nice man at a café They'll fall in love and get married When she looks back on her wedding she'll smile and she’ll think that...
  • 3
  • 322
  • 1
moving as a child part 2 vocabulary

moving as a child part 2 vocabulary

TOEFL - IELTS - TOEIC

... I say pair of knickers… A pair usually means two But we say pair when talking about one pants or one pant So I would say a pair of jeans, a pair of pants, a pair of knickers And I go on to say, ... Look out of place For example: Women in Las Vegas wear a lot of make up and I don’t wear any make up So I felt like I really looked out of place when I was in Las Vegas Look out of place And Joe ... that you have a basic understanding of the vocabulary Go back and listen www.LearnRealEnglish.com © Copyright 20 08: Learn Real English, LLC 12 Moving As A Child Part Vocabulary Lesson to it again...
  • 13
  • 346
  • 1
báo cáo hóa học:

báo cáo hóa học:" Aberrant expression and potency as a cancer immunotherapy target of alpha-methylacyl-coenzyme A racemase in prostate cancer" pptx

Hóa học - Dầu khí

... Gleason score 10 11 12 13 14 15 60 73 65 64 67 67 71 71 72 67 67 61 61 61 60 6.7 6.0 11 .6 15 .6 18 .4 14 . 4 10 .9 4. 6 5.7 8.0 4. 3 11 .5 10 .1 10 .4 6.6 4+ 3 3 +3 4+ 3 3 +4 4+5 4+ 3 3+5 3 +4 3 +4 4 +4 3+ 3 3 +4 4 +3 ... 51Crrelease assay LNCaP -A* 24 0 2 and DU 14 5 -A* 24 0 2, which express both endogenous AMACR and gene-transfected HLA -A* 24 0 2, were used as target cells Parental LNCaP and DU 14 5 cells, HLA -A* 24 0 2- negative ... Page 10 of 11 (page number not for citation purposes) Journal of Translational Medicine 20 09, 7 :10 3 10 11 12 13 14 15 16 17 18 19 20 21 22 tide vaccine for the treatment of patients with metastatic...
  • 11
  • 531
  • 0
Báo cáo y học:

Báo cáo y học: " Laugh syncope as a rare sub-type of the situational syncopes: a case report" potx

Báo cáo khoa học

... Cardiol 20 01, 37 :19 21 - 1 928 Bragg MJ: Fall about laughing: a case of laughter syncope Emerg Med Australas 20 06, 18 : 518 - 519 Arthur W, Kaye GC: Important points in the clinical evaluation of patients ... man JAMA 20 05, 29 3 :28 63 -28 64 Sarzi Braga S, Manni R, Pedretti RF: Laughter-induced syncope Lancet 20 05, 36 6 : 42 6 Totah AR, Benbadis SR: Gelastic syncope mistaken for cataplexy Sleep Med 20 02, 3: 77-78 ... etiology One populationbased study found that cardiac and neurologic syncope were associated with an increased risk of death from any cause and an increased risk of cardiovascular events and stroke,...
  • 4
  • 190
  • 0
báo cáo khoa học:

báo cáo khoa học:" Fanconi anemia manifesting as a squamous cell carcinoma of the hard palate: a case report" pptx

Báo cáo khoa học

... advances Stem Cells 19 94, 12 : 14 2 -15 3 Linares M, Pastor E, Gomez A, Grau E: Hepatocellular carcinoma and squamous cell carcinoma in a patient with Fanconi's anemia Ann Hematol 19 91, 63: 54- 55 LeBrun DP, ... therapy and had not received a bone marrow transplant The haematological test revealed an early stage of pancytopenia (3 ,4 × 10 9/l, Hb 12 ,3 g/dl, and platelets 13 × 10 9/l) Oral examination revealed ... Multiple squamous-cell carcinomas in Fanconi's anemia Cancer 19 82, 50: 811 -8 14 Alter BP: Radiosensitivity in Fanconi's anemia patients Radiother Oncol 20 02, 62: 34 5 - 34 7 Authors' contributions GG drafted...
  • 5
  • 245
  • 0
Báo cáo y học:

Báo cáo y học: " Vascular endothelial growth factor as a non-invasive marker of pulmonary vascular remodeling in patients with bronchitis-type of COPD" pot

Báo cáo khoa học

... (6) 11 1 (6)** 85 (4) ** 22 .9 (1. 9) 46 .0 (6 .2) 21 . 9 (2. 0) 41 .8 (6 .4) ** 5.97 (0.76) 8 .28 (1. 21 ) 5. 91 (0. 81) 7.67 (1. 27 )* Abbreviations: HR = heart rate; MAP = mean arterial pressure; PaO2 = arterial ... expression of vascular endothelial growth factor and vascular endothelial growth factor receptor in emphysema Am J Respir Crit Care Med 20 01, 16 3: 737 -44 Kanazawa H, Asai K, Hirata K, Yoshikawa J: Possible ... Kanazawa H, Okamoto T, Hirata K, Yoshikawa J: Deletion polymorphisms in the angiotensin converting enzyme gene are 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 associated with pulmonary hypertension...
  • 7
  • 257
  • 0
Identification and characterization of protein kinase CK2 as a novel interacting protein of neuronal CDK5 kinase and its functional role in microtubule dynamics

Identification and characterization of protein kinase CK2 as a novel interacting protein of neuronal CDK5 kinase and its functional role in microtubule dynamics

Cao đẳng - Đại học

... localization 1. 1 .2 Regulation of CK2 1. 1 .3 Biological effects of CK2 13 1. 1 .3 .1 Regulation of adhesive proteins 13 1. 1 .3 .2 Regulation of cytoskeletal elements 14 1. 1 .3. 3 Regulation of substrates ... 1. 3 .2. 2 Cdk5 in synapses and focal adhesion sites 31 1 .3 .2. 3 Cdk5 in neurosignaling 33 III 1. 3 .2 .4 Cdk5 in transcriptional machineries 34 1. 3. 3 36 Molecular organization of Cdk5 complexes 1. 3. 3 .1 ... 1. 3. 3 .1 Methods used in isolating protein-interacting partners 38 1 .4 Microtubule Dynamics 40 Materials and Methods 46 2 .1 Materials 47 2 .1. 1 Chemicals and reagents 47 2 .1. 2 Cell lines 48 2 .1. 3 Antibodies...
  • 182
  • 480
  • 0
Báo cáo y học:

Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"

Y học thưởng thức

... (sense, 5’-AAGGAGGCACTGGGAGAGGGGAAAT -3 (bases - 13 23 to - 12 99) and antisense, 5’CCCCACCAAGCCAACACAGGATGGA -3 (bases - 919 to-895) were used to amplify a 42 9-bp product from genomic DNA (Fig 1A) The ... 5’- AAGGAGGCACTGGGAGAGGGGAAAT -3 (bases - 13 23 to - 12 99 from the major transcriptional initiation site) and antisense, 5’-AATTAGCTGGGCATGGTGGCAGGCG -3 (bases -10 75 to -10 51) ) that recognize part ... 20 04; 17 : 1 045 -9 15 1 11 Sano M, Kuroi N, Nakayama T, et al The association study of calcitonin-receptor-like receptor gene in essential hypertension Am J Hypertens 20 05; 18 : 40 3- 8 12 Nakayama...
  • 7
  • 612
  • 1
Lab 4.1.4 Creating a Network Map using CDP

Lab 4.1.4 Creating a Network Map using CDP

Quản trị mạng

... Interface #2 Interface #1 Interface #2 #5 800 (806) Ethernet (E0) Ethernet (E1) 16 00 Ethernet (E0) Ethernet (E1) Serial (S0) Serial (S1) 17 00 FastEthernet (FA0) FastEthernet (FA1) Serial (S0) Serial ... performed 3 -4 CCNA 2: Routers and Routing Basics v 3. 0 - Lab 4. 1 .4 Copyright  20 03, Cisco Systems, Inc Router Interface Summary Router Ethernet Ethernet Serial Serial Interface Model Interface #1 Interface ... prompted for a password, enter class If “class” does not work, ask the instructor for assistance Router>enable At the privileged EXEC mode, enter the command erase startup-config Router#erase startup-config...
  • 4
  • 505
  • 0
Tài liệu Module 4: DNS as a Solution for Name Resolution docx

Tài liệu Module 4: DNS as a Solution for Name Resolution docx

Hệ điều hành

... databases increases as well Similarly, as the DNS zone database size increases, the length of time to resolve DNS queries increases Delegated zones divide a DNS zone database into smaller parts, ... as a traditional primary zone from another BIND-based DNS server To a BIND-based DNS server, Active Directory integrated zones appear as traditional primary zones You can replicate to other Active ... Internet Name Domain (BIND) version 8 .2. 2 Crucial BIND compatibility includes: Incremental zone updates that are supported by BIND version 8 .2 .1 and later A dynamically updated DNS zone database that...
  • 60
  • 373
  • 0
Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc

Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc

Báo cáo khoa học

... hedgehog, an acyltransferase required for palmitoyla- 17 18 19 20 21 22 23 24 25 26 27 28 tion and activity of the Hedgehog signal Science 29 3, 20 80 20 84 Lee JD & Treisman JE (20 01) Sightless has homology ... Petersburg, FL, USA) followed by PCR with Taq DNA polymerase (Promega, Madison, WT, USA) using the primers 5¢-CACACTACACTGGGAAGCAGAGACTCCAGC -3 and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG3¢ The cDNA was subcloned ... for activity J Cell Sci 11 2, 44 05 44 14 FEBS Journal 27 5 (20 08) 31 8 3 31 ª 20 07 The Authors Journal compilation ª 20 07 FEBS Y Abe et al 29 Holst B, Lunde C, Lages F, Oliveira R, Lucas C & Kielland-Brandt...
  • 14
  • 499
  • 0
Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx

Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx

Báo cáo khoa học

... S.S (20 00) Rapid mapping of protein functional epitopes by combi- Ó FEBS 20 04 19 20 21 22 23 24 25 26 27 Phage -display for quantifying protein stability (Eur J Biochem 2 71) 16 29 natorial alanine ... Proc Natl Acad Sci USA 94, 10 1 72 10 177 12 Malakauskas, S.M & Mayo, S.L (19 98) Design, structure and stability of a hyperthermophilic protein variant Nat Struct Biol 5, 47 0 47 5 13 Ross, S .A. , Sarisky, ... association of the variable heavy chain (VH) with protein A was used as a surrogate for direct stability measurements The VH domains in camelid heavy chain antibodies are most similar to the classical...
  • 7
  • 502
  • 0
Tài liệu Module 4: Configuring ISA Server as a Firewall ppt

Tài liệu Module 4: Configuring ISA Server as a Firewall ppt

Quản trị mạng

... 20 04 as a Firewall What Is a TCP/IP Packet? Network Interface Layer Internet Layer Transport Layer Application Layer Destination Address: 0003FFD 32 9 B0 Source Address: 0003FFFDFFFF Physical payload ... 0003FFFDFFFF Physical payload Destination: 19 2 .16 8 .1. 1 Source: 19 2 .16 8 .1. 10 Protocol: TCP IP payload Destination Port: 80 Source Port: 11 59 Sequence: 38 370668 72 Acknowledgment: 29 8 24 7 0 625 HTTP Request Method: ... What Is System Policy? System policy is: A default set of access rules applied to the ISA Server to enable management of the server A set of predefined rules that you can enable or disable as...
  • 31
  • 470
  • 0
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

Báo cáo khoa học

... SRp40 hnRNP A1 , hnRNP E1 ⁄ E2 hnRNP A1 ASF ⁄ SF2 hnRNP A1 UUAGGACAUAUAGUUAGCCCUAGG unknown UGGGU CUAGACUAGA CCAGUAGAUCCUAGACUAGA GAAGAAGCGGAGACAGCGACGAAGA AGAUCCAUUCGAUUAG unknown UAGUGAAUAGAGUUAGGCAGGGA ... UAGUGAAUAGAGUUAGGCAGGGA GAAGAAGAA UAGAAGAAGAA 49 95–5 017 [5, 12 , 38 , 40 ] 53 62 536 6 5 42 8– 5 43 7 5 41 8– 5 43 7 5558–55 82 8 047 –80 62 [48 , 41 , 15 , 17 , 8] A3 A5 A7 ISS ESE3 The HIV -1 encoded proteins Tat, which acts as ... nuclear localization of viral nucleic acids in nondividing host cells Proc Natl Acad Sci USA 91, 7 31 1 –7 31 5 32 Kamata M, Nitahara-Kasahara Y, Miyamoto Y, Yoneda Y & Aida Y (20 05) Importin-alpha promotes...
  • 10
  • 434
  • 0

Xem thêm