discourse psychology of pages 7427 7432 w vonk and l g m noordman pdf
A discourse analysis of economic export contracts in english and vietnamese
... only an essential operational activity but also a legal practice complying with strict legal rules If the EEC is not well compiled and if the language is used in the wrong way, a lot of trouble ... the implication of the study will bring useful and significant knowledge to language users and learners so that they can know and use them effectively in writing, negotiating and signing EECs ... style of official documents” It is not homogeneous and is represented by the following subtypes or variants: +The language of business documents +The language of legal documents +The language of...
- 101
- 797
- 4
A discourse analysis of collective labour agreements in english and vietnamese
... for teaching and learning of English language as well as writing legal documents, especially of them is extremely important In Vietnam, with the increasing establishment of foreign companies, the ... to legally bind the rights and obligations of employer and employees, - To suggest some implications for the teaching and learning of English language to Vietnamese students, especially law students ... RATIONALE Employment is the most important activity of people, creating physical materials as well as mental values for society And collective agreement that must be made under the Labour Law to legally...
- 13
- 604
- 0
THE SOCIOLOGY AND PSYCHOLOGY OF TERRORISM: WHO BECOMES A TERRORIST AND WHY? ppt
... TERRORISM ANALYSIS The Multicausal Approach Terrorism usually results from multiple causal factors—not only psychological but also economic, political, religious, and sociological factors, among others ... individuals come to know about and make sense of the world Terrorists view the world within the narrow lens of their own ideology, whether it be MarxismLeninism, anarchism, nationalism, Islamic fundamentalism ... the lower-risk form of bombing one or more U.S airliners with time7 Library of Congress – Federal Research Division The Sociology and Psychology of Terrorism bombs Yousef was planning simultaneous...
- 186
- 1,092
- 0
Extractive Metallurgy of Copper 4th ed. W. Davenport et. al. (2002) Episode 2 pdf
... cyclones for mining and mineral processing www.krcbs.com (Industrial uses, mining and mineral processing) Larox (2002) Larox [filtration] News www.larox.com MIM (2002) Jameson Cell, technology www.mimpt.com.au ... Cu mineral recovery by flotation The most common grinding mills are: (a) semi-autogenous and autogenous mills (b) ball mills Grinding is always done wet with mixtures of -80 mass% solids and ... procedure maximizes ore throughput and minimizes electrical energy consumption Ball mills tumble iron or steel balls The balls are initially to 10 cm diameter They gradually wear away as grinding proceeds...
- 40
- 342
- 0
Extractive Metallurgy of Copper 4th ed. W. Davenport et. al. (2002) Episode 7 pdf
... pressurized water flowing through cm diameter tubes in the roof and walls of a large (e .g 25 m long x 15 m high x m wide) rectangular chamber (b) a convection section (e .g 20 m long x 10 m high x m wide) ... Extractive Metallurgy of Copper Ross, K .G (1991) Sulphuric acid market review In Smelter Off-gas Handling and Acid Plants, notes from Canadian Institute of Mining and Metallurgy professional enhancement ... Peirce-Smith converting remains a problem for SO2 collection especially during charging and skimming (Fig 1.6b) when gas leaks into the workplace and at ground level around the smelter Adoption of...
- 40
- 256
- 0
Tài liệu Fundamentals of Robotic Mechanical Systems: Theory, Methods, and Algorithms, Second Edition P2 pdf
... orthogonal ball wheels, consisting basically of spherical wheels that can rotate about two mutually orthogonal axes West and Asada (1995), in turn, designed a rolling robot with ball wheels, i.e., ... developed walking machines 1.7 Rolling Robots While parallel manipulators indeed solve many inherent problems of serial manipulators, their workspaces are more limited than those of the latter ... problems are being currently solved using the same tools, namely, differential geometry and Lie algebra (De Luca and Oriolo, 1995) As a means to supply rolling robots with 3-dof capabilities, omnidirectional...
- 20
- 650
- 0
Tài liệu Báo cáo khoa học: MicroRNA-23a promotes the growth of gastric adenocarcinoma cell line MGC803 and downregulates interleukin-6 receptor pdf
... 5¢-TGCGG GTGCTCGCTTCGGCAGC-3¢; U6 reverse, 5¢-CCAGTGC AGGGTCCGAGGT-3¢ PCR cycles were as follows: 94 °C for min, followed by 40 cycles of 94 °C for min, 50 °C for and 72 °C for The SYBR Green Mix ... from AuGCT Inc MTT assay MGC803 cells were seeded in 96-well plates with · 103 cells per well in 100 lL of cell culture medium and incubated at 37 °C for 24 h The cells were then transfected with ... activity of MGC803 cells, a plate colony formation assay was performed Compared with the control group, the colony number of MGC803 cells after transfection with miR-23a ASO was lower and that for MGC803...
- 9
- 541
- 0
Tài liệu Báo cáo khoa học: "The Effect of Corpus Size in Combining Supervised and Unsupervised Training for Disambiguation" pdf
... Alistair Moffat, and Timothy C Bell 1999 Managing Gigabytes: Compressing and Indexing Documents and Images Morgan Kaufman Michael Collins 1997 Three generative, lexicalised models for statistical parsing ... example, indexing both alternatives will create a large number of spurious verb attachments of of, which in turn will result in incorrect high attachments by our disambiguation algorithm For relative ... 4th Discourse Anaphora and Anaphora Resolution Colloquium Daniel M Bikel 2004 Intricacies of Collins’ parsing model Computational Linguistics, 30(4):479–511 Hiram Calvo, Alexander Gelbukh, and...
- 8
- 515
- 0
Tài liệu Báo cáo Y học: Temperature dependence of thermodynamic properties for DNA/DNA and RNA/DNA duplex formation pdf
... rUUACAGCG/d rCGCUGUAA/d rUUGGCACC/d rCUACGCUU/d rAAGCGUAG/d rGAGCCGUG/d rCACGGCUC/d rACUGGAUU/d rAAUCCAGU/d rGGACUCAG/d rCUGAGUCC/d rGAGGUCGU/d rACGACCUC/d rAGUCCUGA/d rGCCGUGAG/d rCUUACGCU/d ... dAGCCG/d dCGTGC/d dCGGTGC/d dCACGGC/d dACCGCA/d dAATACCG/d dAGCTTCA/d dAGCCGTG/d dGGATTGA/d dACCTAGTC/d dCTAGTGGA/d dGTCGAACA/d dGCCAGTTA/d dCGCTGTAA/d dCACGGCTC/d dAATCCAGT/d dAGTCCTGA/d dACGACCTC/d ... dCTCACGGC/d dAGCGTAAG/d dATCTATCCG/d dGCCAGTTAA/d dGCCAGTTAT/d dGCATAATACGT/d RNA/DNA rCGGCU/d rAGCCG/d rGCACG/d rCAAUCG/d rGGCACG/d rCGUGCC/d rGCACCG/d rCGGUGC/d Temperature range (C) Thermodynamic...
- 10
- 447
- 0
Báo cáo khoa học: Haptoglobin binds the antiatherogenic protein apolipoprotein E – impairment of apolipoprotein E stimulation of both lecithin:cholesterol acyltransferase activity and cholesterol uptake by hepatocytes pdf
... equilibrated with 10 mm NaCl in 20 mm Tris ⁄ HCl at pH 7.4 Specifically, the column was loaded with 1.5 mL of sample (about 130 mg of proteins), and the elution was carried out with 10 mm NaCl in 20 mm Tris ... serum, mm l- glutamine, 100 UÆmL)1 penicillin, and 100 lgÆmL)1 streptomycin, and grown at 37 °C in a humidified atmosphere of 5% CO2 in air The internalization of labelled proteoliposomes into HepG2 ... purchased from Sigma-Aldrich (St Louis, MO, USA) DMEM and fetal bovine serum were from BioWhittaker (Verseviers, Belgium); l- glutamine, penicillin and streptomycin were from Gibco (Milano, Italy) ApoA-I,...
- 14
- 445
- 0
Reauthorization of the Export-Import Bank: Issues and Policy Options for Congress pdf
... rising wealth of emerging economies and their growing role in the global economy Currently, a number of emerging market countries operate ECAs.10 Rising economic powers, such as China, India, and ... estimates of new medium- and long-term (MLT) official export credit financing by the Ex-Im Bank, the ECAs of the other G- 7 countries, and selected emerging economies In 2010, new MLT official export ... for Congress Table Legislative Changes to the Export-Import Bank’s Limit on Outstanding Aggregate Credit and Insurance Authority Year Legislation New Limit Resulting from Legislation 1945 P .L 79-173...
- 32
- 416
- 0
Báo cáo sinh học: "Increase of plasma IL-9 and decrease of plasma IL-5, IL-7, and IFN-g in patients with chronic heart failure" potx
... (pg g/ ml) IL-5 (pg/ /ml) * 15 * IL-7 (pg/ml) ) IFN- (pg /m ml) * * 100 * * * 1.2 4.5 C ICM NIDCM C ICM NIDCM Figure Cytokine plasma levels decreased in ICM and NIDCM CHF patients vs controls Plasma ... pg/ml (see http://www.biorad.com/webroot/web /pdf/ lsr/literature/Bulletin_3157 pdf) We tested the plasma concentrations of the above molecules in the whole study population The plasma samples were ... Am Coll Cardiol 1996, 28:964-71 27 Timmers L, Sluijter JP, van Keulen JK, Hoefer IE, Nederhoff MG, Goumans MJ, et al: Toll-like receptor mediates maladaptive left ventricular remodeling and impairs...
- 7
- 424
- 0
Báo cáo hóa học: " On the understanding and development of modern physical neurorehabilitation methods: robotics and non-invasive brain stimulation" pdf
... of motor function following neurological damage, and what we can take from computational motor learning literature to set up training paradigms using robotic devices that might optimally promote ... Virtual Reality technology may overcome these barriers by making physical rehabilitation interesting, challenging and even addictive, all perhaps necessary ingredients for relearning motor skills ... understanding and development of modern neurorehabilitation methods, and outlines some ways to quantify plasticity and recovery of function However, we are only beginning to understand the complex...
- 4
- 452
- 0
báo cáo hóa học: " Reaching in reality and virtual reality: a comparison of movement kinematics in healthy subjects and in adults with hemiparesis" pdf
... reaching and grasping were determined Temporal parameters were movement time, time to peak wrist velocity (RPV), time to maximal hand aperture (RMGA), http://www.jneuroengrehab.com/content/1/1/11 and ... the maximal peak velocity respectively The temporal parameters (time to peak wrist velocity, time to maximal grip aperture) were normalized to movement time and the delay between them was calculated ... virtual ball using movement strategies that were similar to those used for the physical ball (Tables and 3) Arm movement trajectories (Figure 2) were smooth and followed similar paths for movements...
- 7
- 476
- 0
Báo cáo hóa học: " Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" pdf
... CTCCCGGAGATCACTGGCTTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGC Consensus (1467) GGACGGC TCCGCACGGTGCCTGC TCCGGAGAACTTTGATGATTTTTCAAAGTC CTCCCGGAGATCACTGGC GTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGC 1610 ... TCCCTGTCCTCGCTCGCTGGAGCCTGAGCCGTCCGCCTGGGCCTGCGCGCCGGCTCTCGTGCTGGACTCCAGGTGGCCCGGGTCGCGGTGTCGCCCTCCGGTCTCCGGCACCCGAGGGAGGGCGGTGT Consensus (1979) TCCCTGTCCTCGCTCGCTGGAGCCTGAGCCGTCCGCCTGGGCCTGCGCGCCGGCTCTCGTGCTGGACTCCAGGTGGCCCGGGTCGCGGTGTCGCCCTCCGGTCTCCGGCACCCGAGGGAGGGCGGTGT ... GGGCAGGTGGCGGTGGGTCTTTTACCCCCGTGCGCTCCATGCCGTGGGCACCCGGCCGTTGGCCGTGACAACCCCTGTCTCGCAAGGCTCCGTGCCGCGTGTCAGGCGTCCCCCGCTGTGTCTGGGGT GGGCAGGTGGCGGTGGGTCTTTTACCCCCGTGCGCTCCATGCCGTGGGCACCCGGCCGTTGGCCGTGACAACCCCTGTCTCGCAAGGCTCCGTGCCGCGTGTCAGGCGTCCCCCGCTGTGTCTGGGGT...
- 12
- 627
- 0
báo cáo hóa học:" Increase of plasma IL-9 and decrease of plasma IL-5, IL-7, and IFN-g in patients with chronic heart failure" pptx
... (pg g/ ml) IL-5 (pg/ /ml) * 15 * IL-7 (pg/ml) ) IFN- (pg /m ml) * * 100 * * * 1.2 4.5 C ICM NIDCM C ICM NIDCM Figure Cytokine plasma levels decreased in ICM and NIDCM CHF patients vs controls Plasma ... pg/ml (see http://www.biorad.com/webroot/web /pdf/ lsr/literature/Bulletin_3157 pdf) We tested the plasma concentrations of the above molecules in the whole study population The plasma samples were ... Am Coll Cardiol 1996, 28:964-71 27 Timmers L, Sluijter JP, van Keulen JK, Hoefer IE, Nederhoff MG, Goumans MJ, et al: Toll-like receptor mediates maladaptive left ventricular remodeling and impairs...
- 7
- 333
- 0
Báo cáo khoa học " Optimisation of extraction procedure for black fungus polysaccharides and effect of the polysaccharides on blood lipid and myocardium antioxidant enzymes activities " pdf
... as control Diets and tap water were freely available The animals were weighed weekly We followed the general guidelines on the use of living animals in scientific investigations (Council of European ... Reduced glutathione levels (GSH) were determined by Ellman method (1959) modified by Jollow, Mitchell, Zamppaglione, and Gillette (1974) Superoxide dismutase activity was measured at 412 nm by the ... significantly decreased MDA level and increased GSH level in myocardium and blood Results are given in Fig As seen from the table, blood TC, TG, LDL-c levels in untreated model control mice were significantly...
- 8
- 447
- 1
Báo cáo khoa học: "Protection of chicken against very virulent IBDV provided by in ovo priming with DNA vaccine and boosting with killed vaccine and the adjuvant effects of plasmid-encoded chicken interleukin-2 and interferon-g" doc
... was calculated as follows: SI = mean OD of ConAstimulated cells / mean OD of unstimulated cells Enzyme-linked immunosorbent assay (ELISA) of antibodies Blood samples were collected from the birds ... scattered cell depletion in a few follicles; 2, moderate with 1/3-1/2 of the follicles atrophied or with depleted cells; 3, diffuse with atrophy in all follicles; and 4, acute inflammation and acute ... aseptically from chickens before the challenge and at 10 days post-challenge The blood collected from chickens of each group was pooled and then peripheral blood lymphocytes from pooled blood of each...
- 9
- 294
- 0
Báo cáo y học: " The impact of inpatient suicide on psychiatric nurses and their need for support" pdf
... in to the management of the medical institutions (directors of hospitals and managers of nursing departments) verbally and in writing The female/male ratio of the respondents was greater than ... it”) and #12); and one hypervigilance-related symptom, namely #21 (I felt watchful or on-guard) Availability of mental health care programmes and the perceived need for them About 80% (n = 234) of ... relation of nurses to suicidei Most of the responses favoured implementing stafforiented mental health care programmes following a suicide, and recognized the need for developing a more compassionate...
- 8
- 423
- 0
Báo cáo y học: " Influenza H5N1 virus infection of polarized human alveolar epithelial cells and lung microvascular endothelial cells" pdf
... staining and YG critically reviewed the manuscript Acknowledgements We are grateful for the help of Joanne HM Fong, Lynsia LS Tang and Thomas YO Chan with the cell culture, and molecular biology ... human lung microvascular endothelial cells (HLMVE) were purchased from Lonza Walkersville, Inc (US) and maintained in the medium and growth supplements supplied by the manufacturer (EGM-2), which ... days with the small airway culture medium SAGM (Lonza) in the apical and basolateral chambers of the Transwell The cells spread to form a confluent monolayer and the culture medium was changed...
- 12
- 229
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25