0

did the treatment cause a change in behavior

THE STUDY OF THE EFFECTS OF a CHANGE IN THE EXPRESSION OF MIXED LINEAGE LEUKEMIA 5 ON TRANSCRIPTION REGULATION

THE STUDY OF THE EFFECTS OF a CHANGE IN THE EXPRESSION OF MIXED LINEAGE LEUKEMIA 5 ON TRANSCRIPTION REGULATION

Cao đẳng - Đại học

... Antisense 5’-ACGUCACACGUUCGGAGAAdTdT-3’ Sense 5’-CGCCGGAAAAGGGAAAAUAdTdT-3’ Antisense 5’-UAUUUUCCCUUUUCCGGCGdTdT-3’ Sense 5’- CAGCCCUCUGCAAACUUUCAGAAUUdTdT-3’ Antisense 5’-AAUUCUGAAAGUUUGCAGAGGGCUGdTdT3’ ... Collection Bovine serum albumin CREB binding protein Central domain CpG-binding protein Chromatin immunoprecipitation Calf intestinal alkaline phosphatase C terminus 4’ 6-diamidino-2-phenylindole, ... Taken together, chromatin architecture and its dynamic nature has a crucial role in dictating the fate of DNA-related metabolic processes which include DNA repair/recombination/replication, in...
  • 122
  • 307
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "A change in structural diversity and regeneration processes of the spruce virgin forest in Nefcerka NNR (TANAP) in relation to altitude" docx

Báo cáo khoa học

... participate in the regeneration in this stage by 27.9% (2,066 ind/ha) By an analysis of the seedbed in the optimum stage having the characteristics of open canopy it was found out that from the total ... virgin forest is shown in Table and in Fig Based on an analysis of the plots of the spruce virgin forest representing the growth stage we can state that the spruce, as a basic tree species, has a tendency ... and breakdown stages a statistically significant difference in the index was confirmed in the spruce virgin forest in the altitudinal range of 1,300–1,400 m The analysis of the structure of the...
  • 9
  • 390
  • 0
Báo cáo y học:

Báo cáo y học: "Preliminary evidence for a change in spectral sensitivity of the circadian system at night" potx

Báo cáo khoa học

... the data analyses and interpretation, and helped to draft the manuscript All authors read and approved the final manuscript Competing interests The author(s) declare that they have no competing ... pupil area (rPA) was obtained by dividing the pupil area by the iris area Only the rPA values obtained during the light exposure periods were analyzed All of the rPA values for a oneminute recording ... expression of melanopsin in the photosensitive RGCs of the albino Wistar rat follow a circadian pattern Finally, these findings might provide additional insight into the reported changes in visual thresholds...
  • 9
  • 363
  • 0
Báo cáo y học:

Báo cáo y học: "Role of vasopressin in the treatment of anaphylactic shock in a child undergoing surgery for congenital heart disease: a case report" docx

Báo cáo khoa học

... hypoxia and lactic acidosis can maintain all the described pathophysiologic mechanisms and induce a relative deficiency in vasopressin plasma concentration further amplifying the vasoplegic scenario ... available experiences [12], the above described pharmacological rationale and the choice of avoiding escalating therapy with alpha agonists This pharmacological approach allowed us to titrate the ... effects of administered catecholamines [6] Epinephrine has been widely accepted to be the standard medical therapy to reverse cardiovascular collapse in anaphylaxis Because of its α and β adrenergic...
  • 4
  • 370
  • 0
Treatment of Osteoarthritic Change in the Hip - part 1 pps

Treatment of Osteoarthritic Change in the Hip - part 1 pps

Sức khỏe giới tính

... of the femoral head in hips The average PTA at the time of the injury was 47.6° (20°–85°), and the average postoperative PTA was 17.9° (0°–40°) The average PTA after pin removal at the final follow-up ... Replacement Arthroplasty for Advancedand Terminal-Stage Osteoarthritis of the Hip in Middle-Aged Patients M Itoman, N Takahira, K Uchiyama, and S Takasaki 163 Part IV: Total Hip Arthroplasty: ... Capital Femoral Epiphysis Motoaki Katano, Naonobu Takahira, Sumitaka Takasaki, Katsufumi Uchiyama, and Moritoshi Itoman Summary Slipped capital femoral epiphysis (SCFE) is a comparatively rare...
  • 26
  • 273
  • 0
Treatment of Osteoarthritic Change in the Hip - part 2 ppt

Treatment of Osteoarthritic Change in the Hip - part 2 ppt

Sức khỏe giới tính

... after CO, and 9° at the final examination, which indicated that 35° correction was obtained by CO and that this was maintained to skeletal maturity Physeal closure was recognized in all cases without ... prophylactic pinning; this was done when the case was diagnosed as preslippage on radiogram and the patient was obese or had an endocrine abnormality For the radiographic estimation, we measured the ... femoral head running into a concavity, which was the anterior border of the neck; in type B, the anterior outline of the head and neck appeared as a straight line; and in type C, the profile was...
  • 26
  • 282
  • 0
Treatment of Osteoarthritic Change in the Hip - part 3 potx

Treatment of Osteoarthritic Change in the Hip - part 3 potx

Sức khỏe giới tính

... the anterior margin of the femoral head In Situ Pinning for SCFE 63 In type B, the anterior outline of the head and neck appears as a straight line and the anterior margin of the femoral head ... pain in 1, and lower limb pain in The mechanism of injury was sports in patients, falling during running in 1, falling on the stairs in 1, long-distance walking in 1, and unknown in 3: most patients ... Warsaw, IN, USA) in 22 hips after 1992 Clinical and radiographic examinations were undertaken in all patients Clinically, we reviewed the pain and the range of motion (ROM) in the involved hips The...
  • 26
  • 366
  • 0
Treatment of Osteoarthritic Change in the Hip - part 4 docx

Treatment of Osteoarthritic Change in the Hip - part 4 docx

Sức khỏe giới tính

... Follow-up and Its Remodeling Takashi Atsumi, Yasunari Hiranuma, Satoshi Tamaoki, Kentaro Nakamura, Yasuhiro Asakura, Ryosuke Nakanishi, Eiji Katoh, Minoru Watanabe, and Toshihisa Kajiwara Summary Posterior ... anterolateral adequate viable area of the femoral head The authors assumed that the main causes of failure with recollapse were inadequate viable area under the weight-bearing portion below the acetabular ... spherical contour of the medial femoral head (arrow) Joint space was well maintained, and the patient was free from pain Flexion was 80°, abduction was 30°, and Japanese Orthopaedic Association (JOA)...
  • 26
  • 321
  • 0
Treatment of Osteoarthritic Change in the Hip - part 7 ppsx

Treatment of Osteoarthritic Change in the Hip - part 7 ppsx

Sức khỏe giới tính

... Fig 11 a Intraoperative photograph of a woman who had significant intraarticular pathology and simultaneously an acetabular dysplasia b The periacetabular osteotomy was performed through a transtrochanteric ... Surgery 167 Lateral-type OA in the advanced and terminal stage Femoral head having a mushroom shape Hinge adduction must be observed in dynamic radiogram; with adduction, the lateral joint space must ... surface S is a force, directed lateral to the joint, that pushes out the femoral head laterally, in the dysplastic OA, which has an inclined acetabular weight-bearing surface When the articular...
  • 26
  • 395
  • 0
Treatment of Osteoarthritic Change in the Hip - part 8 pps

Treatment of Osteoarthritic Change in the Hip - part 8 pps

Sức khỏe giới tính

... visualization of the acetabulum, allowing acetabular preparation and implant insertion with relative ease Surgery via this approach has many disadvantages First, there is a very steep learning ... Young and R.B Bourne a b Fig Intraoperative fluoroscopic images during two-incision MIS approach a Acetabular reaming during two-incision MIS approach b Femoral stem implantation Minimally Invasive ... to the pin tracks may have enhanced the initial fixation B Nine years after metal-on-metal resurfacing, the patient has resumed a very active lifestyle (including ski racing), and his UCLA hip scores...
  • 26
  • 282
  • 0
Treatment of Osteoarthritic Change in the Hip - part 9 pot

Treatment of Osteoarthritic Change in the Hip - part 9 pot

Sức khỏe giới tính

... feature of the titanium plasmaspray coating is the subject of further investigations Primary and secondary Bicontact implant stability was analysed by Eingartner et al [34] using an X-ray analysis ... transtrochanteric approach by the same surgeon In all cases, the acetabular component was placed at the level of the true acetabulum The mean lengthening of the operated limb was 3.8 cm The average ... and cup or acrylic arthroplasty (9 hips) In no instance, however, was the femoral head replaced into the true acetabulum The indication for THA was pain in the dislocated hip, associated with...
  • 26
  • 311
  • 0
Treatment of Osteoarthritic Change in the Hip - part 10 ppt

Treatment of Osteoarthritic Change in the Hip - part 10 ppt

Sức khỏe giới tính

... both acetabulum and femoral medullary canal These methods permit inserting a normal-sized components into a small original acetabulum and into a narrow femoral canal without further wear of the ... to the level of the original acetabulum, the femoral prosthesis is implanted in the second stage and the joint is reduced To avoid intraoperative nerve damage under anesthesia, monitoring of the ... of the hip in the adult (in Japanese) In: Congenital dislocation of the hip Kanehara, Tokyo, pp 257–266 A Biomechanical and Clinical Review: The Dall–Miles Cable System Desmond M Dall Summary The...
  • 21
  • 442
  • 0
Transplantation of mesenchymal stem cells for the treatment of parkinsons disease in a mouse model

Transplantation of mesenchymal stem cells for the treatment of parkinsons disease in a mouse model

Thạc sĩ - Cao học

... cell transplantation attenuates blood brain barrier damage and neuroinflammation and protects dopaminergic neurons against MPTP toxicity in the substantia nigra in a model of Parkinson’s disease ... demonstrated activated microglia in the SN similar to that observed in PD cases (Langston et al, 1999) Animal model also illustrates that an acute insult to the SN can result in a sustained inflammatory ... sustaining after the initiating agent has disappeared The MPTP model of PD has been invaluable in the studying of the mechanisms of PD pathogenesis, for example, the mechanisms of microglial activation...
  • 200
  • 311
  • 0
Tài liệu The Banker and the Bear The Story of a Corner in Lard ppt

Tài liệu The Banker and the Bear The Story of a Corner in Lard ppt

Quản trị kinh doanh

... Cornering a market is at best a desperate operation; the chances lie heavily on the side of failure It is daring, splendid, Napoleonic; it makes capital reading in the daily papers, and affords the ... most valuable ally The three spent about half their days in the big house, consulting, arguing the advisibility of this change or that, arranging and rearranging, until even Dick admitted she was ... should be on the same terms as the other clerks, the fatherhad barred that form of address in banking hours "Mr Bagsbury," John began again, and now the words came easily, "I was offered another position...
  • 120
  • 701
  • 0
Tài liệu The Color Line A Brief in Behalf of the Unborn pptx

Tài liệu The Color Line A Brief in Behalf of the Unborn pptx

Khoa học xã hội

... Thebes and Memphis, of Rome and Athens and Jerusalem, of Delhi and of Bagdad, of the Pyramids and of the Parthenon the radiant names of Hammurabi and Zarathustra and Moses and the Buddha and Mohammed, ... hurled back the Chinaman into the ocean and barred our ports unyieldingly against him The case against Chinese immigration was not one-hundredth so strong as against the social equality of the Negro; ... eminent anthropologist, while denying everything as a whole, affirms everything in detail that is maintained in the preceding chapters Inasmuch as the Address of this savant may be regarded as...
  • 90
  • 476
  • 0
Tài liệu Báo cáo khoa học: Role of K22 and R120 in the covalent binding of the antibiotic fosfomycin and the substrate-induced conformational change in UDP-N-acetylglucosamine enol pyruvyl transferase docx

Tài liệu Báo cáo khoa học: Role of K22 and R120 in the covalent binding of the antibiotic fosfomycin and the substrate-induced conformational change in UDP-N-acetylglucosamine enol pyruvyl transferase docx

Báo cáo khoa học

... mutant protein is not due to a lack of adduct formation, but rather indicates that the binding process is not associated with a measurable net heat change The finding that binding of UDPNAG to the ... proteins were not stable at 30 °C with stirring in the ITC cell; the data obtained at this temperature was not included in the analysis The raw data were integrated and normalized for molar concentration ... 5¢-GGTTGCGCCATTGGCGCGGTTCCTGT TGACCTGCATATC-3¢; 3¢-primer (R to V): 5¢-GATATG CAGGTCAACAGGAACCGCGCCAATGGCGCA ACC-3¢ The template used for amplification was the pKK233-2 plasmid containing Enterobacter...
  • 9
  • 707
  • 0
Tài liệu The Clyde Mystery a Study in Forgeries and Folklore doc

Tài liệu The Clyde Mystery a Study in Forgeries and Folklore doc

Khoa học xã hội

... bear some of the archaic markings common on the rock faces both in Scotland and in Central Australia: on large rocks they are painted, in Australia, in Scotland they are incised I maintain that ... which appear to be painted, not incised I argued, on the contrary, that things of similar appearance, at Mas d'Azil: in Central Australia: and in Caithness, need not have had the same meaning and ... "practised people." M Cartailhac, again, has lately, in the most The Clyde Mystery, by Andrew Lang candid and honourable way, recanted his own original disbelief in certain wall-paintings in Spanish...
  • 51
  • 565
  • 0
Báo cáo khoa học: Concerted mutation of Phe residues belonging to the b-dystroglycan ectodomain strongly inhibits the interaction with a-dystroglycan in vitro pot

Báo cáo khoa học: Concerted mutation of Phe residues belonging to the b-dystroglycan ectodomain strongly inhibits the interaction with a-dystroglycan in vitro pot

Báo cáo khoa học

... fi Ala reverse Phe718 fi Ala forward Phe718 fi Ala reverse Val736 fi Ala forward Val736 fi Ala reverse GTTAGTAGGTGAGAAATCGGCGGTTCAGTTTAACAGCAACA TGTTGCTGTTAAACTGAACCGCGCATTTCTCACCTACTAAC GAGAAATCGTGGGTTCAGGCCAACAGCAACAGCCAGCTC ... CCTCGTCCTGCCGCCTCCAATGCTCTGGA TCCAGAGCATTGGAGGCGGCAGGACGAGG GCTCTGGAGCCTGACGCCAAGGCTCTGAGTATTGC GCAATACTCAGAGCCTTGGCGTCAGGCTCCAGAGC TGTCGGCACCTCCAGGCTATCCCTGTGGCACCA TGGTGCCACAGGGATAGCCTGGAGGTGCCGACA ACCAGCCACAGAGGCGCCAGACAGGGACC ... GAGAAATCGTGGGTTCAGGCCAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTGGCCTGAACCCACGATTTCTC TCGTGGGTTCAGTTTAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTAAACTGAACCCACGA TCTGCCCCTGGAGCCCTGCCCCA TGGGGCAGGGCTCCAGGGGCAGA CCTCGTCCTGCCGCCTCCAATGCTCTGGA...
  • 15
  • 337
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "On the German Locative: A Study in Symbols" pdf

Báo cáo khoa học

... on the terminal level that actually have structural correlates within the locative formclass That is to say, the locative rules above are to be regarded as inadequate, should the terminal locative ... (d) and then finally to that in (f) Whether regarded as an objectlanguage symbol or a metasymbol, the adverb irgendwo, being the affirmative counterpart to wo, also contains the locative and the ... demonstrated that a definite locative prepositional phrase relates in a different syntactic way to certain locative adverbs than does an indefinite one and that if the latter is to be incorporated into...
  • 17
  • 355
  • 0
Behind the Postmodern Facade: Architectural Change in Late Twentieth-Century America pptx

Behind the Postmodern Facade: Architectural Change in Late Twentieth-Century America pptx

Kiến trúc - Xây dựng

... Congress Cataloging -in- Publication Data Larson, Magali Sarfatti Behind the postmodern facade : architectural change in late twentieth-century America / Magali Sarfatti Larson p cm Includes bibliographical ... progressives among them had already passed from the avant-garde into the service of the government before the war Later, the Scandinavian, the Austrian, and the German architects followed the same path ... estrangement: "In search of raw material, mass culture strips traditional art of its marketable qualities, and leaves as the only remaining path to authenticity a ceaseless alertness against the...
  • 360
  • 815
  • 0

Xem thêm