daikenchuto a traditional japanese herbal medicine in accelerating capsule endoscopy transit time a prospective pilot study
Báo cáo y học: "Pumpless extracorporeal interventional lung assist in patients with acute respiratory distress syndrome: a prospective pilot study" doc
... ischaemia-indicating laboratory values (creatine kinase, lactate)) an immediate removal of the cannulae was prescribed Statistical analysis Statistical analysis was performed using SPSS Software, version ... resulted in a significant improvement in arterial oxygenation and a marked removal in arterial carbon dioxide within two hours allowing a rapid reduction in FiO2, minute ventilation and inspiratory ... previous analysis – clinical data resulting from a strict algorithm with defined indications (and contraindications) • The use of iLA in early ARDS, combined with a refined application technique including...
- 7
- 360
- 0
Báo cáo khoa học: " SemiCytokines levels, Severity of acute mucositis and the need of PEG tube installation during chemo-radiation for head and neck cancer a prospective pilot study" ppt
... cytokines such as IL-1 and TNF -a [2] The pro-inflammation cytokines IL-1 and TNF -a are present in high levels in blood and serum during inflammation, and anti-inflammation cytokines are at low ... participated in the design of the study and carried out the laboratory analysis All authors read and approved the final manuscript Page of Competing interests The authors declare that they have no ... cytokines in patients with head and neck cancer Clin Cancer Res 1999, 5:1369-1379 Kanazawa T, Nishino H, Hasegawa M, Ohta Y, Iino Y, Ichimura K, Noda Y: Interleukin-6 directly influences proliferation...
- 7
- 341
- 0
Báo cáo y học: "Traditional herbal medicine in Far-west Nepal: a pharmacological appraisal" potx
... contributed as antipyretic in home herbal remedy in study area were Andrographis paniculata (Acanthaceae), Aconitum spicatum (Ranunculaceae) and Osmanthes fragrans (Oleaceae) Andrographolide and neoandrographolide ... Gupta MM, Srivastava GN, Abraham Z, Singh AK: Dictionary of Indian medicinal plants Central Institute of Medicinal and Aromatic Plants (CIMAP) Lucknow, India; 1992 182 Garcia-Argaez AN, Ramirez-Apan ... Piyusavarsi Ausadhalaya Mahaboudha, Kathmandu, Nepal; 1979, 230 22 Dash B, Gupta K: Materia medica of Ayurveda based on Mandanapala’s Nighantu B Jain Publishers, New Delhi, India; 1994, 780 Kunwar...
- 18
- 656
- 0
In silico approaches in the study of traditional chinese herbal medicine
... time in medicine and the necessity to revisit the study of traditional medicines such as traditional Chinese medicine (TCM) is explained At the end of this chapter the motivation and approaches ... representing antioxidation and Yang as oxidation Their proposal is partially supported by the fact that the Yin-tonic traditional Chinese herbs on average have about six times more antioxidant activity ... TCM 14 anthraquinones such as emodin and aloe-emodin In Chapter 5, a literature-based approach is conducted to search for the molecular mechanisms of herbal synergism Finally, in the last chapter...
- 198
- 515
- 0
Báo cáo y học: "A prospective observational study of the relationship of critical illness associated hyperglycaemia in medical ICU patients and subsequent development of type 2 diabetes"
... [25] Acute coronary syndrome, unstable angina and myocardial infarction were defined according to the ACC/AHA criteria [26,27] Statistical analyses MedCalc™ v 9.6.2.0 (MedCalc Software, Mariakerke, ... statistical software was used for all statistical analyses Categorical data are presented as absolute and relative frequencies, continuous variables as median with inter-quartile range (IQR) Since ... Shimatani Y, Kurisu S, Hata T, Nakama Y, Kijima Y, Kagawa E: Is admission hyperglycaemia in non-diabetic patients with acute myocardial infarction a surrogate for previously undiagnosed abnormal...
- 8
- 656
- 1
Báo cáo khoa học: " Medication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive care unit"
... causing no harm or an increase in patient monitoring with no change in vital signs and no harm noted Moderate errors were classified as those causing an increase in patient monitoring, a change in ... was involved in critically revising the draft JG made substantial contributions to the data analysis GB was substantially involved in the analysis, interpretation and drafting the manuscript Acknowledgements ... menus at a dose of mg/kg instead of mg, which could have lead to a 70 times overdose In a separate case, amphotericin 180 mg once daily was prescribed, when liposomal amphotericin was intended...
- 6
- 526
- 0
Tài liệu Manifestations of Pulmonary Tuberculosis in the Elderly: A Prospective Observational Study from North India pptx
... The study was cleared by the ethics committee of the Institute Informed consent was taken for each subject Statistical Analysis Quantitative and qualitative data are expressed as median [inter-quartile ... with ageing and hence must be kept in mind during the diagnostic evaluation of elderly patients.11 Several findings of the current study are in accordance with the results of this meta-analysis In ... important and crucial step for preventing a diagnostic delay while evaluating elderly patients Infact, TB is often not even considered in the differential diagnosis by treating physicians and an incorrect...
- 6
- 680
- 3
báo cáo hóa học: " Effect of dexamethasone on quality of life in children with acute lymphoblastic leukaemia: a prospective observational study" pdf
... subscales for determining problems in relevant areas during cancer treatment such as pain, nausea, treatment and procedural anxiety, worry, cognitive problems, perceived physical appearance and ... coordination of the study, gathering and processing of data (questionnaires), performed the statistical analyses, drafting and revising of manuscript JH: participated in the design of the study and ... Since at the start of this study recruitment for ALL-9 had ceased and a new treatment protocol had already started, inclusion was maximized by including all children still treated according to ALL-9...
- 8
- 474
- 0
Báo cáo hóa học: " Quality of life in children three and nine months after discharge from a paediatric intensive care unit: a prospective cohort study" pdf
... measurement in pediatric clinical practice: an appraisal and precept for future research and application Health Qual Life Outcomes 2005, 3:34 Balluffi A, Kassam-Adams N, Kazak A, Tucker M, Dominguez ... population are available The instruments measure HRQoL on a group level in a reliable and valid way Reliability (Cronbach's alpha) in the general populations are moderate to good (0.59–0.84) for all ... a tertiary PICU with 14 beds admitting patients from the greater Amsterdam area Medical, surgical and trauma patients and patients from all pediatric subspecialties are admitted In this study...
- 9
- 440
- 0
báo cáo hóa học:" Long term outcomes of antiretroviral therapy in a large HIV/AIDS care clinic in urban South Africa: a prospective cohort study" docx
... antiretroviral therapy (HAART) has increased dramatically, but the majority of those in need remain untreated, especially in sub-Saharan Africa With more than five million individuals living with HIV and ... demonstrates that rapid scale-up of HAART using a public health approach in sub-Saharan Africa, essential to confronting the HIV/AIDS epidemic, can be accompanied by high quality care The analysis ... Systems - SA) database, and analyzed in SAS v9.1.3 (SAS Institute, NC, USA) Data quality Results were regularly controlled for quality by a senior nurse or data quality assurance manager Duplicate entry...
- 11
- 332
- 0
báo cáo hóa học:" Couples’ voluntary counselling and testing and nevirapine use in antenatal clinics in two African capitals: a prospective cohort study" pot
... in antenatal clinics, we trained clinic staff at two antenatal clinics in Lusaka, Zambia, and two antenatal clinics in Kigali, Rwanda, to provide same-day rapid VCT, CVCT and appropriate NVP for ... editing and submission of the article, and the final analysis of the data ES assisted with this study in Kigali, Rwanda, and Lusaka, Zambia, and conducted the preliminary analyses, writing and ... activities in Lusaka, Zambia AT contributed to the data analysis and manuscript preparation MS was the Director of the Lusaka District Health Management Team in Zambia and facilitated the study conduct...
- 10
- 388
- 0
báo cáo hóa học: " Older People’s Quality of Life (OPQOL) scores and adverse health outcomes at a one-year follow-up. A prospective cohort study on older outpatients living in the community in Italy" docx
... living at home so that data on survival and living arrangements one year after the baseline visit were available for all (Figure 1) The main characteristics of the participants at the baseline ... like using the telephone, shopping, Page of 10 preparing meals, housekeeping, doing laundry, taking medications, managing transportation and handling money [36] When any fall and any ED admission ... subjective well-being may act as a buffer, moderating the negative effects of adverse circumstances and facilitating the adaptation to ageing [1] As far as the prognostic relevance of QOL and HRQOL is...
- 10
- 694
- 0
báo cáo hóa học:" Does self-regulation and autonomic regulation have an influence on survival in breast and colon carcinoma patients? results of a prospective outcome study" potx
... physiological measures, another epidemiological available approach is measuring rest/activity regulation with a validated assessment applicable in clinical settings as a part of a questionnaire measuring ... developed as an epidemiological, preventive health care and clinical measure in a long and short version, and has been validated, applied and evaluated against physical risk factors prospectively in ... female/66.7%) (C) gave their written consent and took part in an initial evaluation in 2000/2001 (table 1) According to our institutional standard in 2000, we did not ask ethical approval in anonymous...
- 11
- 538
- 0
báo cáo hóa học:" Effect of dexamethasone on quality of life in children with acute lymphoblastic leukaemia: a prospective observational study" pdf
... subscales for determining problems in relevant areas during cancer treatment such as pain, nausea, treatment and procedural anxiety, worry, cognitive problems, perceived physical appearance and ... coordination of the study, gathering and processing of data (questionnaires), performed the statistical analyses, drafting and revising of manuscript JH: participated in the design of the study and ... Since at the start of this study recruitment for ALL-9 had ceased and a new treatment protocol had already started, inclusion was maximized by including all children still treated according to ALL-9...
- 8
- 317
- 0
Báo cáo toán học: " The impact of blood pressure hemodynamics in acute ischemic stroke: a prospective cohort study" ppt
... impact of blood pressure hemodynamics in acute ischemic stroke: a prospective cohort study Latha Ganti Stead *1,4, Sailaja Enduri1, M Fernanda Bellolio1, Anunaya R Jain1, Lekshmi Vaidyanathan1, ... lstead@ufl.edu; latha.stead@gmail.com SE: sailaja.enduri@ht.msu.edu MFB: bellolio.fernanda@mayo.edu ARJ: rabinstein.alejandro@mayo.edu LV: lekshmi.vaidyanathan@emory.edu RMG: gilmore.rachel@mayo.edu ... STATEMENTS None of the authors have any competing interests References American Heart Association: International Cardiovascular Disease Statistics— Statistical Fact Sheet—Populations, 2008 Update...
- 18
- 340
- 0
Báo cáo khoa học: "Ultrasound-guided central venous catheterization in cancer patients improves the success rate of cannulation and reduces mechanical complications: A prospective observational study of 1,978 consecutive catheterizations" pps
... Grande Casa Reale e Ducale di Piacenza e Parma, Pro Loco Gazzola, I Fantastici Author details Oncology-Hematology Department, Hospital of Piacenza, Piacenza, Italy Department of Medicine, AUSL Piacenza, ... data and clinical features were analyzed using descriptive methods Quantitative variables were summarized using mean and standard deviation Categorical variables were summarized as counts and ... because of anatomical variation or difficult veins (small veins; no palpable landmarkers) Anatomical variations of the internal jugular vein were found in 8% of patients studied with ultrasound-guided...
- 7
- 422
- 0
Báo cáo khoa học: "Neoangiogenesis in early cervical cancer: Correlation between color Doppler findings and risk factors. A prospective observational study" pot
... Figure cancer with color vascularization Transvaginal scanty Doppler ultrasound showing a cervical Transvaginal color Doppler ultrasound showing a cervical cancer with scanty vascularization The amount ... Kamura T, Tsukamoto N, Tsuruchi N, Saito T, Matsuyama T, Akazawa K, Nakano H: Multivariate analysis of the histopathologic prognostic factors of cervical cancer in patients undergoing radical ... data collection, analysis, patient recruitment and management and preparation of the manuscript RMM was involved in patient recruitment and management, helped in preparation of draft RG was involved...
- 7
- 271
- 0
Báo cáo khoa học: "Parotid gland-recovery after radiotherapy in the head and neck region: 36 months follow-up of a prospective clinical study" pdf
... cancer; irradiation, saliva; hyposalivation; parotid gland sparing; recovery Background Sparing salivary glands during radiotherapy (RT) is an important research field in the treatment of head and neck ... study, we have already shown that the remaining stimulated saliva in these patients is not able to maintain oral health due to its pH and its buffer capacity [20] In fact it promotes dental caries ... manuscript and aided in the analysis DV participated in the coordination CG and TK conceived of the study, and participated in its design and coordination All authors have approved the final manuscript...
- 25
- 342
- 0
Báo cáo y học: "Systemic TNF blockade does not modulate synovial expression of the pro-inflammatory mediator HMGB1 in rheumatoid arthritis patients – a prospective clinical study" ppt
... β-actin, forward CCTTCGTGCCCCCCC and reverse GGAGAC- CAAAAGCCTTCATACATC; and for HMGB1, forward ATTGGTGATGTTGCGAAGAA and reverse GATCCACAGCAACTCCAGAA The volume was adjusted to 15.5 μl using RNase-free ... HMGB1 and inhibit its release [34] Oxaliplatin is an antineoplastic platinum-based compound that generates DNA adducts that strongly bind HMGB1 Therefore, gold salts and oxaliplatin share the capacity ... Vishnubhakat JM, Ombrellino M, Che J, Frazier A, Yang H, Ivanova S, Borovikova L, Manogue KR, Faist E, Abraham E, Andersson J, Andersson U, Molina PE, Abumrad NN, Sama A, Tracey KJ: HMG-1 as a late...
- 8
- 529
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25