customers deeply research characteristics of industrial customers to define appropriate types of credits and minimize risks of credit for these types of customers
research characteristics of shen shu point (UB23) and the effect of EA in the treatment of LBP with kidney failure type
... Fu and the most familiar name today is acupoint - The classification of acupoint: These can be divided into three main types of acupoint: acupoint of meridian, acupoint of external meridian, and ... evaluation of analgesic effect of EA This is a real success in science and research of traditional medicine So far the conclusion is only qualitative in nature The research and application of EA in ... inserts the needle into acupoint to stimulate the body's reaction to balance Qui, to circulate meridian, to create the Yin-Yang eQuilibrium to achieve the purpose of prevention and healing Electro-acupuncture...
- 25
- 296
- 0
Báo cáo hóa học: " Research Article Wireless Mesh Networks to Support Video Surveillance: Architecture, Protocol, and Implementation Issues" potx
... combination of shape analysis and tracking and constructs models of people’s appearances in order to detect and track groups of people as well as monitor their behaviors even in the presence of occlusion ... header TORA is an adaptive on-demand routing protocol designed to provide multiple loop-free routes to a destination, thus minimizing reaction to topological changes The protocol belongs to the ... signal and image processing, computer vision, communications, and hardware The automated analysis and processing of video surveillance is a central area of study for the computer vision and pattern...
- 13
- 286
- 0
Báo cáo hóa học: " Research Article Applying Novel Time-Frequency Moments Singular Value Decomposition Method and Artificial Neural Networks for Ballistocardiography" docx
... frequency noises, and so forth Thus, we had to use a bandpass filter to extract the heart-originated BCG signal According to our experience, if we use a bandpass filter of [3, 14] Hz to smooth the ... of BCG signals for pattern recognition purposes, and remove other components Of course, for monitoring or other purposes, we must use another type of filtering, but for our application this bandwidth ... essential information of a matrix, somewhat similarly as the eigenvalues A singular value and the corresponding singular vectors of a rectangular matrix A are a scalar σ and a pair of vectors u and v...
- 9
- 314
- 0
Review current credit and treasury controls to improve cash management and minimize risks at exxonmobil Vietnam
... recommendations and ideas for improving cash management and reducing credit risks for the next years 3 SCOPE AND LIMITATION OF RESEARCH STUDY This research will concentrate on the Treasury and Credit ... when credit is granted These receivables include credit granted to other firms, called trade credit, and credit granted customers, called consumer credit W.S Baumol, “The transactions Demand for ... gathering credit information, how to score credit in order to analyze as well as to grant credit limit to customers In next chapter, we will state an overview of ExxonMobil corporation in the world and...
- 150
- 189
- 0
PrefaceThe research field of robotics has been contributing widely and significantly to industrial doc
... null-space of P and corresponds to the internal forces; iv) I − P + P is a matrix formed corresponds to the by orthonormal basis vectors which span the null space of P , and magnitude of the internal forces ... (front left leg) of the six-legged walking robot Thus, before to analyze in depth the time diagrams of Figs to 8, it may be useful to refer to the motion analysis of the leg tip and to remind that ... together to perform a step and, then, legs 4, and move together to perform another step of the six-legged walking robot Both steps are performed with a suitable phase shift according to the input...
- 458
- 282
- 0
Phương pháp nghiên cứu tâm lý học tổ chức, công nghiệp, nhân sự Handbook of Research Methods in Industrial and Organizational Psychology
... perfect complement to non -research based handbooks in psychology Handbook of Research Methods in Industrial and Organizational Psychology Edted by Steven G Rogelberg Handbook of Research Methods ... misinformation as truth; (2) the inability to synthesize knowledge; and (3) misinformed and potentially destructive applications of knowledge The Handbook of Research Methods in Industrial and ... comprehensive and contemporary treatment of research philosophies, approaches, tools, and techniques indigenous to industrial and organizational psychology The overall vision of this handbook is to promote...
- 13
- 836
- 0
Evaluation of the Characteristics of Microorganisms that Contribute to Denitrification in the Paddy Drainage Treatment Apparatus by Quinone Composition Measurement
... shows the factor loading of PC1 and PC2 As for PC1, Q-8, Q-9, MK-9(H2) and MK-11(H2) indicated higher factor loading values Content of these quinones were 5.1 - 15.7% for Q-8, 3.6 13.7% for Q-9, ... appears to be the key factor for denitrification in the paddies in addition to the apparatus for paddy surface drainage treatment This information is an important indicator of the stabilization of ... 2% for MK-9(H6), and less than 1% for MK-11(H2) The contributions of MK-9(H2) and MK-11(H2) were neglected, because the contents of MK-9(H6) and MK-11(H2) were very small PC1 was considered to...
- 7
- 570
- 0
Get Your Customers to Sell for You: 5 Tips
... one of your existing customers There are two ways to make this happen The cheapest method is to have a support forum in which customers can answer questions The trick here is that it has to be ... easy for prospects to register and ask questions Also, you'll need to keep an eye on the forum to make sure that dissatisfied customers don't start bad-mouthing A more elegant approach is to put ... existing customers end up purchasing the product! Give your best customers promotional offers to share Once you've developed your network, you can get them to share your special offers with friends and...
- 3
- 391
- 0
Tài liệu INDUSTRIAL TECHNOLOGY ASSESSMENTS: An Evaluation of the Research Program of the Office of Industrial Technologies doc
... Parks, and Marsha Quinn of the Department of Energy’s Office of Industrial Technology The committee is particularly grateful to Jim Quinn and Denise Swink and the staff of the Office of Industrial ... needs and priorities of each IOF group and consider several factors, such as the size of the industrial community, the potential effect of the research on OIT goals, the ability of the industry to ... came together to develop the industry’s vision The CTOs first took stock of the current forest, wood, and paper industry and then described the desired state of the industry 25 years into continued...
- 70
- 613
- 0
Báo cáo khoa học: DNA-binding characteristics of the regulator SenR in response to phosphorylation by the sensor histidine autokinase SenS from Streptomyces reticuli doc
... site I), C and D (to delete site II), E and F (to delete site III), G and H (to delete the perfect inverted repeat) and I and F (to delete simultaneously sites II and III) were ligated to each other ... (located upstream of hbpS and ending at the 5¢-end of binding site III) GCCGAATTCCGCCGGACCGGATG (located upstream of hbpS and beginning at the 3¢-end of binding site III) For sequence and characteristics, ... Response regulator SenR Table List of primers used to obtain mutated SenR-binding sites Fragment A B C D E F G H I Primer name IHinfor IEcorev IEcofor IPstrev IIHinfor IIEcorev IIEcofor IIPstrev...
- 14
- 428
- 0
Báo cáo Y học: Characteristics of binding of insulin-like growth factor (IGF)-I and IGF-II analogues to the type 1 IGF receptor determined by BIAcore analysis pptx
... group of analogues were designed to probe for the IGF1R-binding site Leu24-IGF-I and Ala31-IGF-I were not able to prevent apoptosis at concentrations of nM, where levels of apoptosis between 25 and ... were determined at a ¯ow rate of 30 lLámin)1 to minimize mass transfer effects, and by allowing 300 s for association and 900 s for dissociation In the case of IGF-I and related analogues, the concentrations ... lower af®nities to the rhIGF1R than IGF-I (Fig 1F±H and Table 1) The association and dissociation rates of these analogues were too rapid to be accurately measured, and therefore their steady-state...
- 8
- 482
- 0
Cancer Research UK’s strategy 2009–2014: Cancer Research UK’s aim is to reduce the number of deaths from cancer. Our future plans are ambitious, but they are in line with the challenge and the responsibility we face. docx
... range of experts and organisations to understand what causes delay in diagnosis, establish the best ways of helping the public to recognise symptoms and to get them checked out by a doctor, and to ... complexity and statistics Our research work is often difficult for non-experts to understand, so we aim to translate the complexity of cancer into easily understandable and accessible information, ... screening and prevention - Continue to fund research into behavioural change relating to tobacco control and sun awareness - Increase our investment in symptom awareness and early diagnosis and lead...
- 32
- 396
- 0
Báo cáo " Characteristics of Quaternary sedimentary facies in relation to water bearing capacity of aquifers and aquicludes in the Red River Delta, Vietnam " ppt
... cycle of Hai Hung Formation, composed of greenish gray clay and peat of lagoon and coastal swamp facies. ‐ The fifth sequence was formed in Late Holocene and composed of sand, ... mainly of greenish gray fine clayey sand of lagoonal and coastal swamp facies of Hai Hung Formation in the upper sequence and the fine sediments of deltaic and marine facies of Vinh Phuc Formation in the lower sequence. ... sequence was formed in Early Pleistocene and corresponded with Le Chi Formation. The sediments of this sequence are composed mainly of cobbles, pebbles, and coarse sand of river channel environment in the ...
- 7
- 671
- 0
báo cáo hóa học:" Pain in cancer. An outcome research project to evaluate the epidemiology, the quality and the effects of pain treatment in cancer patients" pptx
... according to the usual practice (standard of care) and followed over time using standardized methods and forms to make possible a valid and reliable description of case-mix, pattern of care and outcomes ... conduct and supervision In order to be able to conduct and monitor the progress of the trial for the patients' safety and according to the World Medical Association Declaration of Helsinki and the ... - To describe the characteristics of a large sample of cancer patients in terms of case mix (patients characteristics) , pattern of care (pharmacological and non-pharmacological treatments) and...
- 7
- 448
- 0
Báo cáo hóa học: " Synthesis and characteristics of NH2-functionalized polymer films to align and immobilize DNA molecules" potx
... cyclohexane, and then, they were treated by DBD method in N2 at a RF power of 150 W for 60 s to form the functional groups on the surface region and to show the subsequent changes of the chemistry ... 642-716, Republic of Korea Department of Chemistry and Institute of Basic Science, Sungkyunkwan University, Suwon, 440-746, Republic of Korea Quantum Optics Lab, Korea Atomic Energy Research Institute, ... signals and strong reduction of the C1s signal The N1s peak for the N2 plasmatreated polymer film was resolved into three peaks at 399.2, 400.4, and 401.7 eV (Figure 1b) These peaks correspond to...
- 17
- 353
- 0
Báo cáo hóa học: " Review of thermo-physical properties, wetting and heat transfer characteristics of nanofluids and their applicability in industrial quench heat treatment" pot
... behaviour of nanofluids so far and the possible mechanisms for the increment of thermal conductivity of the nanofluids are as follows [43-63]: I Brownian motion of nanoparticles: The Brownian motion of ... behaviour of nanofluids into four groups as dilute nanofluids, semidilute nanofluids, semi-concentrated nanofluids, concentrated nanofluids [85] Xinfang et al measured the viscosity of Cu-H O nanofluid ... constant for all materials and addition of alloying elements to the steel shift the nose of TTT curve (Figure 4) [102] Therefore, the heat treaters need different types of quenching media to provide...
- 15
- 434
- 0
Báo cáo hóa học: " Research Article An Alternative Method to Compute the Bit Error Probability of Modulation Schemes Subject to Nakagami-m Fading" pdf
... Figure 9: BEP for 16 × 32-QAM subject to Nakagami fading for different values of m, ranging from 1.25 to 1.55 referred to as Detector DI and Detector DII, as described in Section 7.4.1 Detector DI Considering ... Figure 10: BEP for I × J-QAM subject to Rayleigh fading (m = 1) and different values of I and J Table 1: Number of real operations required by detector DI to obtain the estimate s(t) of the transmitted ... obtained from (46) to (53) Results for the 16 × 32-QAM scheme for m ranging from 0.51 to 0.80 and from 1.25 to 1.55 are presented, respectively, in Figures and Comparing Figures and 9, for the same...
- 12
- 404
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25