create a for statement that uses a counter that begins at 0 and ends at 14 increasing by 1 with each loop
macromedia flash mx advanced for windows and macintosh
... Information Using Variables and Expressions Loading External Variables Storing and Sharing Information Modifying Variables Concatenating Variables and Dynamic Referencing Testing Information with ... the same to create the animated loop (Figure 1. 11) Figure 1. 11 The position of the earth at keyframe and at keyframe 18 in Layer are the same Select the middle frame of the guided layer, and insert ... the animation not have to play two identical frames (the first and the last) and creates a smooth loop A motion path in a guide layer provides a way to create smooth movement along a path from...
- 819
- 4,244
- 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf
... Fe[Q69G /A1 41Q] 1 10 0 ( 10 0 ) 86 (7.8) 12 2 (11 ) 363 (33) 304 8 ( 10 0 ) 2 41 (8) 366 (12 ) 8 01 (26) 2 605 227 457 965 ( 10 0 ) (8) (17 ) (37) 3 500 16 20 5285 4929 415 3 8257 ( 10 0 ) (84) (0) (16 7) a Manganese superoxide ... together with oligonucleotides ECF-Q69G d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) ... for 1 2 h and used to inoculate 50 mL of 2TY media containing 10 0 lgÆmL )1 ampicillin, 50 lM ferric sulfate, 50 lM manganese sulfate, 2 50 lM paraquat and 0. 1 mM IPTG to an initial D 600 of 0. 03...
- 12
- 740
- 0
Báo cáo Y học: The N-terminus of m5C-DNA methyltransferase Msp I is involved in its topoisomerase activity docx
... mutagenesis kit from Stratagene The sequence of the oligonucleotides for the mutations at the underlined positions were: 5¢-ACATGGC AACAGGCGGAATCAGGTAAA-3¢ (W3 4A) and 5¢ -AT ATTCTAGAAAGCTAACCAGAATCAA-3¢ ... template, a PCR amplification of truncated MspI (deletion of 34 N-terminal amino acids; del34aa) was made using the following set of primers: 5¢-CATATGgaatcaggtaaaaca-3¢ and 5¢-tgttttacctgattccCATATG-3¢ ... EDTA mM, 2-mercaptoethanol 14 mM, glycerol 10 % ) containing unlabeled 14 5 9-bp BstXI DNA fragment of /X174 as substrate ( 50 nM DNA) and 200 nM AdoMet ( 80 mCiÆmmol )1) The reactions were initiated by...
- 7
- 515
- 0
Báo cáo khoa học: The transmembrane domain of subunitbof theEscherichia coli F1FOATP synthase is sufficient for H + -translocating activity together with subunitsaandc doc
... Bacteriol 1 60, 10 5 5– 10 6 0 20 Iwamoto, A. , Omote, H., Hanada, H., Tomioka, N., Itai, A. , Maeda, M & Futai, M (19 91) Mutations in Ser174 and the glycine-rich sequence (Gly149, Gly1 50, and Thr156) in the ... supplemented with thiamine (2 lgÆmL )1) , thymine, asparagine, isoleucine and valine ( 50 lgÆmL )1 each) together with 75 mM glycerol as carbon source, harvested at late exponential phase and stored at ) 80 ... stoichiometric amounts were calculated based on the amino acid analysis performed during the synthesis of b1)34 and calibrated with the FO sample assuming a stoichiometry of ab2c 10 Dialysis was carried...
- 7
- 233
- 0
Báo cáo toán học: "The Quantum Double of a Dual Andruskiewitsch-Schneider Algebra Is a Tame Algebra" pdf
... algebras, J Pure and Applied Algebra 204 ( 200 6) 413 –454 H-L Huang, H-X Chen, and P Zhang, Generalized Taft algebras, Alg Collo 11 ( 200 4) 313 –3 20 H Krause, Stable Equivalnece Preserves Representation ... representation type are Taft algebras and the dual of A( n, d, μ, q), which as an associative algebra is generated by two elements g and x with relations g n = 1, xd = μ (1 − g d ), xg = qgx with comultiplication ... representations of a class of quanrum doubles, J Algebra 225 ( 200 0) 3 91 409 H-X Chen, Finite-dimensional representation of a quantum double, J Algebra 2 51( 200 2) 7 51 789 Xiao-Wu Chen, Hua-Lin Huang,...
- 19
- 386
- 0
Báo cáo sinh học: "The genetic control of ovariole in Sitophilus oryzae L is temperature sensitive" pptx
... type at 29°C and mutant type at 21 C, Foster and Suzuki, 19 70) ; and in a homeotic mutation affecting imaginal discs, giving normal arista segment of the antennal complex at 29°C and a tarsus at 17 °C, ... Temperature-sensitive mutations in Drosophila melanogaster V .A mutation affecting concentrations of pteridines Proc Nat Acad Sci USA 67, 1 10 1 -1 10 8 Grigliatti T, Suzuki DT (19 71) Temperature-sensitive mutations ... Tiegs, 19 35; Vernier, 19 70; Ganesalingam, 19 74) At the anterior tip of each ovariole, a bacteriome containing intracellular bacteria is formed (Mansour, 19 30; Nardon, 19 71) This apical bacteriome...
- 18
- 273
- 0
Báo cáo y học: "Neurophysiological study to assess the severity of each site through the motor neuron fiber in entrapment neuropathy" potx
... patients were bilaterally affected Fifty four patients had CTS hands on the unilateral side and 54 contra-lateral hands were asymptomatic The diagnosis of CTS in all patients was reconfirmed at ... median nerve stimulation The other143 hands had complete data for all CMCT, CRL, PL and MDL In median nerve measurement, CMCT was 7 .15 ± 1. 37 ms, CRL was 1. 72 ± 0. 73 ms, PL was 9.25 ± 1 .06 ms and ... 0. 000 1) relationship with the CMAP amplitude The typical symptoms of cervical myelopathy are numbness and clumsy hands [ 21- 23] In addition, Friedenberg and Miller found that degenerative changes...
- 7
- 298
- 0
Báo cáo y học: "Effects on respiratory function of the head-down position and the complete covering of the face by drapes during insertion of the monitoring catheters in the cardiosurgical patien" pot
... and C) at times and A similar comparison between times and showed a small nonsignificant increase in PaO2 and SaO2 in groups A1 and B1, and a significant increase (P < 0. 05) in PaO2 and SaO2 in ... Compared with the basal conditions and time for groups A2 and B2 and time for groups A1 , B1, C, PaO2 and SaO2 increased significantly (P < 0. 05) in all patients supplied with oxygen (groups A1 , B1, and ... (mmHg) A2 78.6 ± B1 68.8 ± B2 SaO2 (%) 14 7 .2 ± 41* 78 .1 ± 87.9 ± 19 C 11 1.9 ± 28 15 7 ± 42† 11 6 ± 25* 82.7 ± 78.7 ± 14 10 2 .5 ± 13 * 97.8 ± 17 14 6 .5 ± 33* 88.2 ± 10 86.7 ± 10 81. 3 ± 11 ‡ 14 4 .8 ± 27‡ 208 .7...
- 5
- 373
- 0
Báo cáo y học: "The acute effects of body position strategies and respiratory therapy in paralyzed patients with acute lung injury" doc
... alleviate hypoxemia (pulse oximetry saturation less than 90% ) Statistical analysis All data were collected and analyzed with commercially available data management and statistical software All data ... 35 15 0. 60 16 11 F 57 Aspiration pneumonia – direct ARDS 33 21 10 0. 60 14 12 M 63 Aspiration pneumonia – direct ARDS 38 23 10 0.55 13 F 30 Multiple stab wounds – indirect ARDS 29 27 14 0. 5 15 14 ... indirect ARDS 27 20 12 0. 50 20 18 M 60 Perforated gastric ulcer, aspiration pneumonia – direct ARDS 38 22 10 0. 60 13 F 55 Esophagectomy, pneumonia – indirect ARDS 0. 70 17 12 M, 7F 49 ± 17 19 N = 19 ...
- 7
- 320
- 0
Mark the letter a, b, c, or d on your answer sheet to indicate the word that differs from the rest in the position of the main stress in each of the following questions
... laughed at B laughing his mistakes at C his mistakes laughing at D his mistakes at laughing Question 47: I can’t go with you today; I have…………… things to A a great deal B many a great C great many ... caribou C The seal D The buffalo Question 80 Which of the following is NOT mentioned by the author as a dwelling place of early North America? A Log cabins 10 11 12 13 14 15 16 17 18 19 20 B Adobe ... Mountains and the Pacific Ocean They gathered seeds and hunted small animals such as rabbits and snakes In the Far North, the ancestors of today’s Inuit hunted seals, walruses, and the great whales...
- 13
- 3,561
- 0
Mark the letter a b c or d on your answer sheet to indicate the word that differs from the rest in the position of the main stress in each of the following questions
... because the weather was so bad C The bad weather was the reason that made our excursion to London have been fallen over D Our plans for an excursion have fallen away because the weather was bad ... bounces and glides along the ground A at 40 miles per hour of an average speed B at an average speed of 40 miles per hour C of 40 miles per hour at an average speed D of an average speed at ... her for original ideas A Being creative, we all can rely on Jenny for original ideas B Creative as Jenny is, we all can rely on her for original ideas C So creative is Jenny that we all can rely...
- 15
- 4,212
- 0
Báo cáo y học: "The evolving story of medical emergency teams in quality improvement"
... medical chart review Crit Care Med 200 3, 31: 10 0 6- 10 1 1 Hayward RA, Hofer TP: Estimating hospital deaths due to medical errors: preventability is in the eye of the reviewer JAMA 200 1, 286: 415 -4 20 ... problems in care and leads to strategies to reduce them Competing interests The authors declare that they have no competing interests References 10 11 12 13 14 15 Iyengar A, Baxter A, Forster AJ: Using ... Med 200 6, 1: 296- 305 Braithwaite RS, DeVita MA, Mahidhara R, Simmons RL, Stuart S, Foraida M: Use of medical emergency team (MET) responses to detect medical errors Qual Saf Health Care 200 4, 13 :255259...
- 2
- 427
- 0
Báo cáo y học: "The Versatile Use of Temporoparietal Fascial Flap"
... 200 9; 12 3(2): 556- 61 Navarro-Ceballos R, Bastarrachea RA Clinical applications of temporoparietal hair-bearing flaps for male pattern baldness and mustache formation Aesthetic Plast Surg 19 91; ... Throat J 19 91; 70: 311 -7 Brent B, Byrd HS Secondary ear reconstruction with cartilage grafts covered by axial, random, and free flaps of temporoparietal fascia Plast Reconstr Surg 19 83; 72(2): 14 1 -52 ... superficial temporal artery The frontal and parietal branches are similar in size and frontal branch is less variable than parietal branch.9, 10 The temporal vessels are located deeper at the level...
- 7
- 727
- 0
Báo cáo y học: "Anticancer Activity of the PR Domain of Tumor Suppressor RIZ1"
... 0. 01% trypan blue for 10 and then examined under a microscope At least 10 0 cells were counted for each treatment Statistical analysis was performed using GraphPad InStat (GraphPad Software, San ... Breast Colon Kidney Liver Lung Ovary Prostate Thyroid FD 3 .1 1 .1 0. 6 0. 8 1. 3 1. 9 0. 7 0. 5 P-value 0. 006 0. 976 0. 0 70 0.384 0. 768 0. 615 0. 3 51 0. 028 The most interesting discovery was that the RIZ1 ... prostate cancer (Fig 1) Because cancer undergoes metastasis and spreads to other organs at late stages, we speculated that RIZ1 might play an important role in tumor metastasis, although increases...
- 7
- 467
- 0
Báo cáo y học: "Effects of Losartan on expression of connexins at the early stage of atherosclerosis in rabbits"
... 1. 68 0. 13 ** 2. 81 0. 20 3 .16 0. 20 1. 36 0. 18 1. 61 0. 15 ** 2.82 0. 20 3 .07 0. 16 Data were expressed as mean±SD P 0. 01 vs Normal group; Losartan group vs high fat diet group P ** 0. 05 Morphologic changes ... Cx43 and Cx 40 of different groups Normal group High fat diet group Losartan group Cx43 (n=7) 0. 63 0. 10 Cx 40 (n=7) 0. 71 0. 13 1. 39 0. 08** 1. 17 0. 12 ** 0. 96 0. 09*## 1 .07 0. 14 **P
- 8
- 467
- 0
Báo cáo y học: "The Natural History of Hepatitis C Virus (HCV) Infection"
... El-Serag H.B, et al Extrahepatic manifestations of hepatitis C among United States male veterans Hepatology, 200 2 36(6): 14 3 9-45 52 69 Cacoub P, et al Extrahepatic manifestations associated with ... Hepatitis C virus related cirrhosis: time to occurrence of hepatocellular carcinoma and death Gut, 200 0 47 (1) : 13 1-6 65 Chiba T, et al Multivariate analysis of risk factors for hepatocellular carcinoma ... (Baltimore), 200 0 79 (1) : 47-56 70 Lunel F and Cacoub P Treatment of autoimmune and extrahepatic manifestations of hepatitis C virus infection J Hepatol, 19 99 31 (Suppl 1) : 2 10 - 6 Author biography...
- 6
- 530
- 0
Báo cáo y học: "Foundation for the Community Control of Hereditary Diseases, Budapest, Hungary"
... selective abortion, i.e termination of pregnancy after the prenatal diagnosis of severe fetal defects was also named as secondary prevention Recently the WHO and other international bodies have excluded ... congenital cardiovascular malformations (e.g ventricular and atrial septal defects, rest of patent ductus arteriosus, etc), congenital pyloric stenosis, undescended testis, etc Tertiary prevention ... of primary prevention Tsitologija i Genetika 200 2; 36: 56- 71 Figure Figure Classification of Congenital Anomalies Congenital Anomalies (Birth Defects) Congenital abnormality (CA) (e.g neural-tube...
- 2
- 626
- 0
Báo cáo y học: "Gene Therapy: The Potential Applicability of Gene Transfer Technology to the Human Germline"
... 200 3; 68(5) :1 903 -19 10 52 Perry ACF, Wakayama T, Kishikawa H, et al Mammalian transgenesis by intracytoplasmic sperm injection Science 19 99; 284(5 417 ) :11 80- 11 83 Int J Med Sci 200 4 1( 2): 76- 91 ... 200 3; 69(6): 200 7- 2 01 4 10 0 Reubinoff BE, Pera MF, Fong CY, et al Embryonic stem cell lines from human blastocysts: somatic differentiation in vitro Nat Biotechnol 200 0; 18 (4):399- 404 10 1 Zwaka ... Science 200 1; 293(5532): 10 9 3- 10 9 8 11 5 Wakayama T, Yanagimachi R Mouse cloning with nucleus donor cells of different age and type Mol Reprod Dev 200 1; 58(4):376-383 11 6 Riele HT, Maandag ER, Berns A...
- 16
- 506
- 1
Báo cáo y học: "The primary prevention of birth defects: Multivitamins or folic acid"
... 20 30 23 50 31 0. 60 (0. 38, 0. 96) 30 11 40 30 70 41 0. 57 (0. 39, 0. 85) 0. 19 (0. 03, 1. 18) 0 0.33 (0. 01, 3. 71) 0. 25 (0. 05, 1. 16) 10 0.24 (0. 05, 1 .14 ) 0. 00 (0. 00, 26.8) 0. 20 (0. 04, 0. 90) 0. 77 (0. 22, ... 1 .06 0. 04 – 0. 86 CAs Limb reduction CAs 0. 25 0. 05 – 1. 16 0. 69 0. 41 – 1. 16 0. 89 0. 62 – 1. 26 Omphalocele 2 . 01 0. 44 – 10 . 81 1 .07 0. 57 – 2 .02 0. 60 0.32 – 1. 13 New candidate CAs Hypospadias 0. 62 0. 32 ... 1. 16 0. 63 – 2 .13 0. 65 0. 35 – 1. 19 0. 04 – 0. 90 stenosis* Rectal/anal 0. 20 0 .02 – 1. 69 0. 46 0. 17 – 1. 23 0. 39 0. 17 – 0. 88 atresia/stenosis Obstructive urinary 0. 19 0. 64 0. 37 – 1. 12 0. 70 0.46 – 1 .06 ...
- 12
- 487
- 0
Báo cáo y học: "Study of the early steps of the Hepatitis B Virus life cycle"
... References 10 11 12 13 14 15 16 17 18 19 20 21 22 Seeger C and Mason WS Hepatitis B virus biology Microbiology & Molecular Biology Reviews 200 0 64 (1) : 51- 68 Mason WS and Seeger C Hepadenavirus-molecular ... RNAmediated silencing of genomic tandem repeats and transposable elements in the D melanogaster germline Current Biology 200 1 11( 13): 10 1 7-27 82 Brenda LB Double-Stranded RNA as a Template for ... Ueda K, Okubo K, Shiozawa M, and Matsubara K An in vitro system for infection with hepatitis B virus that uses primary human fetal hepatocytes PNAS USA 19 89 86(6): 18 75 -18 79 76 Galle PR, Haglestein...
- 13
- 654
- 1
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose