cpe of syncytium formation associated with measles virus replication in a vero cells
Báo cáo y học: "Aplastic anemia associated with interferon alpha 2a in a patient with chronic hepatitis C virus infection: a case report" pptx
... doi:10.1186/1752-1947-4-268 Cite this article as: Ioannou et al.: Aplastic anemia associated with interferon alpha 2a in a patient with chronic hepatitis C virus infection: a case report Journal of Medical Case Reports ... tests at presentation, late onset of AA), it is unlikely that the HCV infection alone was the cause of his ensuing AA Bone marrow aplasia may also occur as an idiosyncratic drug reaction, with a ... 2a in the growing body of literature As health care providers, physicians should be aware of this rare but life-threatening complication of PEG-IFNa 2a treatment Abbreviations AA: aplastic anemia;...
- 5
- 352
- 0
Báo cáo y học: "Use of near-infrared light to reduce symptoms associated with restless legs syndrome in a woman: a case repor" ppt
... FDAapproved drugs on the market for the treatment of RLS Now ropinirole and pramipexole, both dopamine agonists, are available Unfortunately these drugs can cause insomnia, nausea, dyspepsia, and ... Pathophysiology, and Pharmacology Pharmacol Rev 1991, 43(2):109-142 23 Hawkins D, Abrahamse H: Phototherapy - a treatment modality for wound healing and pain relief African Journal of Biomedical Research 2007, ... this case report Anodyne was used, but there are other similar devices available for healthcare providers Anodyne is FDA approved for increasing circulation and reducing pain, and it has been...
- 5
- 318
- 0
Báo cáo y học: " Use of near-infrared light to reduce symptoms associated with restless legs syndrome in a woman: a case report" docx
... FDAapproved drugs on the market for the treatment of RLS Now ropinirole and pramipexole, both dopamine agonists, are available Unfortunately these drugs can cause insomnia, nausea, dyspepsia, and ... Pathophysiology, and Pharmacology Pharmacol Rev 1991, 43(2):109-142 23 Hawkins D, Abrahamse H: Phototherapy - a treatment modality for wound healing and pain relief African Journal of Biomedical Research 2007, ... this case report Anodyne was used, but there are other similar devices available for healthcare providers Anodyne is FDA approved for increasing circulation and reducing pain, and it has been...
- 5
- 227
- 0
Báo cáo y học: " Risk of malnutrition is associated with mental health symptoms in community living elderly men and women: The Tromsø Study" pdf
... study revealed statistically significant associations using both a categorical and a more dimensional approach Page of Somatic diseases, especially stroke, myocardial infarction and cancer, represent ... (SPSS inc., Chicago, Illinois, USA) Results Baseline characteristics of the 1558 men and 1553 women included in the analyses are shown in Table The mean age was 71.2 years in men and 72.0 years in ... study sample was lower than that of the non-attending persons, and the mean age was also lower than that of the participants not included in the study sample because of missing values The BMI of...
- 8
- 402
- 0
Báo cáo y học: " Bilateral undisplaced insufficiency neck of femur fractures associated with short-term steroid use: a case report" pps
... Figure reported as 'no taken at the Plain radiographbony injury' time of initial presentation and Plain radiograph taken at the time of initial presentation and reported as 'no bony injury' Three ... effects include: suppression of osteoblastic activity, reduction of intestinal calcium absorption, increased urinary calcium excretion and decreased renal tubular calcium absorption This in turn leads ... and clinical assessor of the patient, assisting with conception of the case report and approval the final manuscript Consent Written informed consent was obtained from the patient for publication...
- 3
- 267
- 0
Báo cáo khoa học: "Impaired antiviral activity of interferon alpha against hepatitis C virus 2a in Huh-7 cells with a defective Jak-Stat pathway" pdf
... Hutchinson AA, Crenshaw AT, Bashirova A, Corrington M: Variants in Interferon-alpha pathway genes and response to pegylated interferon-alpha 2a plus ribavirin for treatment of chronic hepatitis ... recombinant DNA fragment containing 70 amino acids of NS 5A (nts.73397546) fusion with the first amino acids of EGFP-N1 was amplified using a sense primer (S/7336-7360/HCV5’-CCTCCCCCAAGGAGACGCCGGACA-3’) ... cytometric analysis We also determined that replication of HCV 2a can only be inhibited by IFN -a in a dose dependent manner in Huh-7 cells with a functional Jak-Stat pathway Replication of the full-length...
- 16
- 391
- 0
báo cáo hóa học:" Treatment of refractory hip pain with sodium hyaluronate (Hyalgan©) in a patient with the Marshall-Smith Syndrome: A case report" pot
... dysplasia of both acetabula, and severe osteoarthritis and subluxation of both hip joints On physical examination, the patient was small in stature (4ft 2in, 65lbs) and had obvious craniofacial abnormalities ... caution in patients with sensitivities to avian proteins, feathers, and egg products It also carries a similar side-effect profile, including local inflammation, injection site pain and itching, anaphylaxis/anaphylactoid ... Syndrome and debilitating, painful bilateral hip dysplasias using intra-articular sodium hyaluronate injections This management option should be Salter et al Journal of Orthopaedic Surgery and Research...
- 5
- 462
- 0
báo cáo hóa học:" Treatment of refractory hip pain with sodium hyaluronate (Hyalgan©) in a patient with the Marshall-Smith Syndrome: A case report" ppt
... dysplasia of both acetabula, and severe osteoarthritis and subluxation of both hip joints On physical examination, the patient was small in stature (4ft 2in, 65lbs) and had obvious craniofacial abnormalities ... caution in patients with sensitivities to avian proteins, feathers, and egg products It also carries a similar side-effect profile, including local inflammation, injection site pain and itching, anaphylaxis/anaphylactoid ... Syndrome and debilitating, painful bilateral hip dysplasias using intra-articular sodium hyaluronate injections This management option should be Salter et al Journal of Orthopaedic Surgery and Research...
- 5
- 393
- 0
Báo cáo y học: " Inhibitory effect of small interfering RNA on dengue virus replication in mosquito cells" ppsx
... AACUGUGCAUUGAAGCCAAAA 929 DenSi-3 DenSi-4 AACAGGGCUAGACUUCAAUGA AAGAAGAAUGGAGCGAUCAAA 1320 133 control siRNA UUCUCCGAACGUGUCACGUdT – Four siRNA sequences (table 1) against different parts of the ... the chance for mismatch rate At the same time, introduction of dsRNAs longer than 30 base pairs into mammalian cells will activate the potent interferon and protein kinase R antiviral pathways, ... passaged every to days to maintain exponential growth DEN-1 strain GZ02-218 was passaged by infecting monolayers of C6/ 36 cells and viruses were harvested at 12-14 days TCID50 of virus was measured...
- 8
- 361
- 0
báo cáo khoa học: " Transcription profiles of mitochondrial genes correlate with mitochondrial DNA haplotypes in a natural population of Silene vulgaris" doc
... between-family and limited within-family variation of mt DNA markers in the offspring under study Within-sibship variation was attributable to paternal inheritance, lineage sorting or maybe to the rearrangement ... different haplotypes in the atp1 flanking regions (a4 1, a4 2, a4 4, a5 2, a4 5 and a5 4; figure 1a, Table 1) Additional faint bands were observed in nearly all RFLP patterns (94%) in at least one combination ... cox1 gene and internal primers were developed to sequence the atp1 gene (AtpA297F: TCGACGTGTCGAAGTGAAAG; AtpA1170R: TCTGAGCCAAATTGAGCAAA) DNA nucleotide sequences of the cox1 and atp1 coding regions...
- 11
- 163
- 0
Effects of serial passaging on west nile virus (sarafend) in a mouse model
... fatal encephalitis About 20 percent of infected patients display a range of symptoms including fever, headache, malaise, back pain, myalgias, eye pain, pharyngitis, nausea, vomiting, diarrhoea, ... regions of mutations iii Testing of passaged and unpassaged virus morbidity and mortality levels in suckling and adult mice iv Infecting primary mouse neural cells with passaged and unpassaged viruses ... postulated that NS1 protein has a role to play in early virus replication It was also found to co – localise to double stranded viral RNA, NS 4a protein, and intracellular membranes (Lindenbach and Rice,...
- 217
- 326
- 0
báo cáo khoa học: "Co-existence of acute myeloid leukemia with multilineage dysplasia and Epstein-Barr virus-associated T-cell lymphoproliferative disorder in a patient with rheumatoid arthritis: a case report" docx
... factor, anti-RNP antibody, and anti-SS -A antibody Bilateral hand X-rays showed mild swelling and destruction of the metacarpo-phalangeal (MP) and proximal-inter-phalangeal (PIP) joints He was diagnosed ... Hoshida Y, Xu JX, Fujita S, Nakamichi I, Ikeda J, Tomita Y, Nakatsuka S, Tamaru J, Iizuka A, Takeuchi T, Aozasa K: Lymphoproliferative disorders in rheumatoid arthritis: clinicopathological analysis ... K, Kanamori H, Higashihara M, Hotta T, Ishigatsubo Y: Remission of lymphoma after withdrawal of methotrexate in rheumatoid arthritis: relationship with type of latent Epstein-Barr virus infection...
- 6
- 314
- 0
Báo cáo y học: " Research In silico modeling of the specific inhibitory potential of thiophene-2,3-dihydro-1,5-benzothiazepine against BChE in the formation of β-amyloid plaques associated with Alzheimer''''s disease" doc
... Choudhary MI, Nawaz SA, Zaheer-ul-Haq , Lodhi MA, Ghayur MN, Jalil S, Naheed Riaz, Yousuf S, Malik , Abdul , Gilani AH, Atta-ur-Rahman : Withanolides, a new class of natural cholinesterase inhibitors ... F, Khalid A, Nawaz SA, Khan MR, Choudhary MI: New cholinesterase-inhibiting steroidal alkaloids from Sarcococca saligna Helvetica Chimica Acta 2004, 87:439-448 17 Atta-ur-Rahman , Feroz F, Naeem ... changes that occur upon ligand binding It was the goal of this docking and scoring evaluation to investigate as systematically and exhaustively as possible the current state of the art in docking...
- 26
- 279
- 0
Tài liệu Báo cáo "REMARKS ON LOCAL DIMENSION OF FRACTAL MEASURE ASSOCIATED WITH THE (0, 1, 9) - PROBLEM " pdf
... dimention of the self - similar sets with overlaps,J London Math Soc ( to appear) 11 Le Xuan Son, Pham Quang Trinh and Vu Hong Thanh Local Dimension of Fractal Measure associated with the (0,1 ,a) -Problem, ... if and only if it contains (1, a, 0) or (0, a, 9), for any a ∈ D Proof It is easy to see the proof of this claim By Claim 3.3, we call each element in the set {(1, a, 0), (0, a, 9)}, for any a ... convolution associated with the golden number, Trans Amer Math Soc 349(1997), 2917 - 2940 T Hu and N Nguyen, Local dimensions of fractal probability measures associated with equal probability weight,...
- 18
- 458
- 0
Tài liệu Báo cáo khoa học: The distinct nucleotide binding states of the transporter associated with antigen processing (TAP) are regulated by the nonhomologous C-terminal tails of TAP1 and TAP2 ppt
... C-terminal tail of TAP2 induces a conformation in NBD2 that is nonpermissive for ATP binding The resulting ADP-binding state of TAP2 and the C-terminal tail of NBD1 allow binding of ATP to TAP1 ... C-terminal tail and results in an ÔATP-onÕ state of TAP2 The structural alteration in TAP2 a ects ATP binding of TAP1 via allosteric cross-talk of the core NBDs and induces ATP hydrolysis in NBD1 ... directly involved in the regulation of nucleotide binding In the natural human TAP2 allele, TAP 2A, a premature termination signal creates a polypeptide lacking the C-terminal 17 amino acids of the...
- 16
- 407
- 0
Báo cáo " SINGULARITY OF FRACTAL MEASURE ASSOCIATED WITH THE (0, 1, 7) - PROBLEM " potx
... overlaps,J London Math Soc ( to appear) 10 Le Xuan Son, Pham Quang Trinh and Vu Hong Thanh Local Dimension of Fractal Measure associated with the (0,1 ,a) -Problem, the case a = 6.Journal of Science, ... 55-71 J C Lagarias and Y Wang, Tiling the line with translates of one tile, Inventions Math 124(1996), 341 - 365 S M Ngai and Y Wang, Hausdorff dimention of the self - similar sets with overlaps,J ... paper is organized as follows In Section we establish some auxiliary results used in the proof of the Main Theorem The proof of the Main Theorem will be given in the last section Some Auxiliary...
- 13
- 335
- 0
RISK OF PULMONARY TUBERCULOSIS ASSOCIATED WITH EXOGENOUS REINFECTION AND ENDOGENOUS REACTIVATION IN A SOUTH INDIAN RURAL POPULATION-A MATHEMATICAL ESTIMATE* doc
... secretarial help and Mr B.R Narayana Prasad graphics References Krishnamurthy, VV, Nair, SS, Gothi, GD, a Chakraborty, AK Incidence of Tuberculosis among newly infected population and in relation ... authors are grateful to Dr A. K Chakraborty, Deputy Director, CGHS, Bangalore for his comments and suggestions at the draft stage of the paper, Mrs.Anuradha for statistical assistance, Miss T.J Alamelu ... tuberculosis (as a result of reactivation) and NRI are as explained above The first term in the above equation viz., NI x A is equivalent to the total new cases arising from the group of persons with...
- 5
- 257
- 0
Indoor Air Pollution Associated with Household Fuel Use in India: An exposure assessment and modeling exercise in rural districts of Andhra Pradesh, India doc
... India Dr Kalpana Balakrishnan Mr Sankar Sambandam Dr Padmavathi Ramaswamy Dr Joerg Arnold Mr R Ayyappan Mr D Venkatesan Ms D Bhuvaneswari Mr A Anand Principal investigator (exposure assessment) ... coordinator Data analysis Team member Team member Team member Team member Team member Institute of Health Systems, Hyderabad, India Dr Satish Kumar Dr P.V Chalapathi Rao Dr Prasantha Mahapatra Mr ... Cooking period & time-activity recall Cooking period Area Personal and area Personal Area Area Area Personal Area personal Area Types of measurement (area or personal) Living Kitchen, living and...
- 114
- 415
- 0
Báo cáo khoa học: Production and utilization of hydrogen peroxide associated with melanogenesis and tyrosinase-mediated oxidations of DOPA and dopamine docx
... varying amounts of the diphenol into solutions of NaCl ⁄ Pi (pH 7.4) that lacked catalase (A and B) and those with catalase (C) Arrows indicate times when dopamine was incorporated in the reaction ... determine rates of reaction The rate of DOPA autoxidation was 0.8 pmÆmin)1 In reaction mixtures containing DOPA and tyrosinase, the rate of substrate oxidation 2409 Hydrogen peroxide in tyrosinase-mediated ... means and ranges for at least three replicate experiments averaged 77 pmÆmin)1, approximately 1.5 times faster than in incubations with catalase The rate of DOPA oxidation averaged 53 pmÆmin)1...
- 9
- 393
- 0
Báo cáo "LOCAL DIMENSION OF FRACTAL MEASURE ASSOCIATED WITH THE (0, 1, a) - PROBLEM: THE CASE a = 6 " pptx
... 1997 K J Falconer, Fractal Geometry, Mathematical Foundations and Applications,John Wiley & Sons, 1993 A Fan, K S Lau and S M Ngai, Iterated function systems with overlaps, Asian J Math 4(2000), ... questions related to Probability, Fractal, Wavelets, East - West J of Math Vol 2, No 1(2000), 55-71 J C Lagarias and Y Wang, Tiling the line with translates of one tile, Inventions Math 124(1996), ... n, where #A denotes the cardinality of set A (2) Local dimension of fractal measure associated with 33 Two sequences (x1 , x2 , , xn ) and (x1 , x2 , , xn ) in Dn are said to be equivalent, denoted...
- 14
- 387
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008