contracts irrevocable commitments and letters of intent and documents published on a website
Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx
... Serological methods Rabbit antisera against Citrobacter strains PCM 1531 and PCM 1487 were prepared as described previously [21] Passive haemagglutination and inhibition of passive haemagglutination ... Part of a two-dimensional 1H,13C HSQC spectrum of the O-specific polysaccharide (OPS) of Citrobacter braakii PCM 1531 One-dimensional 1H and 13C NMR spectra are displayed along the horizontal and ... conclusion was confirmed and the a configuration of ara4dHex established using a NOESY experiment This showed H1,H3 and H1,H5 correlations for Rha at d 4.97/4.06 and 4.97/3.58, which are characteristic...
- 7
- 478
- 0
Báo cáo toán học: " Existence and uniqueness of nonlinear deflections of an infinite beam resting on a non-uniform nonlinear elastic foundation" pptx
... detail, and formulate an integral equation equivalent to the nonlinear and non-uniform beam equation The properties of the nonlinear, non-uniform elastic foundation are analyzed in Section 3, and ... equation for the elastic deformation of a beam supported on an elastic, nonlinear foundation Kuo et al [10] obtained an asymptotic solution depending on a small parameter by applying the perturbation ... applications, say, to highways and railways The analysis of the problem is thus of interest to many mechanical, civil engineers and, so on: a number of researchers have made their contributions...
- 38
- 349
- 0
báo cáo hóa học:" Existence and uniqueness of nonlinear deflections of an infinite beam resting on a non-uniform nonlinear elastic foundation" docx
... detail, and formulate an integral equation equivalent to the nonlinear and non-uniform beam equation The properties of the nonlinear, non-uniform elastic foundation are analyzed in Section 3, and ... equation for the elastic deformation of a beam supported on an elastic, nonlinear foundation Kuo et al [10] obtained an asymptotic solution depending on a small parameter by applying the perturbation ... applications, say, to highways and railways The analysis of the problem is thus of interest to many mechanical, civil engineers and, so on: a number of researchers have made their contributions...
- 38
- 215
- 0
Báo cáo khoa học: "Isolated recurrence of distal adenocarcinoma of the extrahepatic bile duct on a draining sinus scar after curative resection: Case Report and review of the literature" pptx
... D'Angelica M, DeMatteo RP, Wagman R, Blumgart LH, Fong Y: Patterns of initial disease recurrence after resection of gallbladder carcinoma and hilar cholangiocarcinoma: implications for adjuvant therapeutic ... twelve months after finishing adjuvant treatment, the patient presented again with abdominal pain, fever, and hypotension A mass in the right upper quadrant was palpated on physical exam and imaging ... strategies Cancer 2003, 98:1689-1700 Kitagawa Y, Nagino M, Kamiya J, Uesaka K, Sano T, Yamamoto H, Hayakawa N, Nimura Y: Lymph node metastasis from hilar cholangiocarcinoma: audit of 110 patients...
- 4
- 491
- 0
Báo cáo y học: " In vitro activities of novel 4-HPR derivatives on a panel of rhabdoid and other tumor cell lines" docx
... VA, Kyritsis AP: Fenretinide activates caspases and induces apoptosis in gliomas Clin Cancer Res 1999, 5(8):2230-2235 Tiwari M, Kumar A, Sinha RA, Shrivastava A, Balapure AK, Sharma R, Bajpai ... final concentration of ethanol remained constant in all wells of each assay 4- 14 HPR was purchased from ONBIO (CAS# 65646-68-6) and all derivatives were synthesized by the author Dr Bhaskar ... was used to elaborate data Analysis of cell death was performed by gating for the sub-G1 population during FACS as previously described [7] Statistical analysis Statistical analysis of the data...
- 32
- 337
- 0
Tài liệu DSXi™ Panels and Bays Connecting on a Whole New Level doc
... sophisticated, DSX panels remain at the very heart of networks That’s why ADC, The Broadband Company™ and the industry’s leading supplier of DSX-1 equipment, continues to innovate and enhance traditional ... can save valuable floor space By configuring a low-profile 84-circuit DSXi panel measuring only four inches high, you can increase your bay capacity from 11 standard panels to 14—for a total of ... traditional DSX panels to improve density, manageability, and delivery Take a look at DSXi from ADC It’s connecting on a whole new level increased density Connect with DSXi panels and bays, and you...
- 6
- 378
- 0
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt
... made up of a nine-stranded b-sheet flanked by a1 , a5 and g2 on one side and by a2 , a3 , a4 and g1 FEBS Journal 275 (2008) 5855–5864 ª 2008 The Authors Journal compilation ª 2008 FEBS A Pappachan ... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG ... towards pNPP at an acidic pH, around 5.5, and Tt SurE was maximally active at pH 8.2 St SurE shows almost no activity in the absence of divalent metal ions Activation by various metal ions was...
- 10
- 553
- 0
The 1998 bleaching event and its aftermath on a coral reef in Belize doc
... shelf lagoon, as well as on the outer barrier reef and in the lagoon at Glovers Reef, an atoll-like carbonate platform seaward of the barrier reef (McClanahan and Muthiga 1998; Aronson and Precht ... the manuscript, as did the comments of an anonymous reviewer M .A. Toscano acknowledges the assistance of R.P Stumpf (NOAA/National Ocean Service) and K.S Casey (NOAA/National Oceanographic Data Center) ... components for graphical representation and as proportional covers for statistical analysis Repeated-measures analysis of variance (ANOVA) was used to compare the proportional covers of individual...
- 13
- 583
- 0
Báo cáo khoa học: "Automatic Acquisition of English Topic Signatures Based on a Second Language" potx
... disambiguation methods In Proceedings of the International Conference on Theoretical and Methodological Issues in Machine Translation, pages 101–112 Rada Mihalcea and Dan I Moldovan 1999 An automatic ... is the website for People’s Daily, one of the most influential newspaper in mainland China It maintains a vast database of news stories, available to search by the public Among other reasons, we ... signatures from Japanese text In particular cases, where one only cares about translation ambiguity, this technique can work on any language pair Conclusion and Future Work We presented a novel...
- 6
- 471
- 0
Báo cáo hóa học: " Research Article Inference of Gene Regulatory Networks Based on a Universal Minimum Description Length" pot
... Networks of Plausible Inference, Morgan Kaufmann, San Francisco, Calif, USA, 1988 [2] N Friedman, M Linial, I Nachman, and D Pe’er, “Using Bayesian networks to analyze expression data,” Journal of ... observe that λi and fi can be estimated separately for each gene This is possible because, for each evaluation of fi , Xi is regarded as fixed and known Even if a network was constructed so that a gene ... Shmulevich, A Saarinen, O Yli-Harja, and J Astola, “Inference of genetic regulatory networks via best-fit extensions,” in Computational and Statistical Approaches to Genomics, pp 197–210, chapter 11,...
- 11
- 244
- 0
báo cáo khoa học: "Solid tumors of the pancreas can put on a mask through cystic change" ppsx
... lesions with cystic features: a review of 418 cases and a classification proposal Virchows Arch 2004, 445:168-178 10 Kimura W, Sata N, Nakayama H, Muto T, Matsuhashi N, Sugano K, Atomi Y: Pancreatic ... of a ductal adenocarcinoma into the wall of a pancreatic pseudocyst Pancreas 1996, 12:416-419 Garcea G, Ong SL, Rajesh A, Neal CP, Pollard CA, Berry DP, Dennison AR: Cystic lesions of the pancreas ... neoplasms and a comparison with their solid counterparts Eur J Surg Oncol 2006, 32:553-556 17 Kamisawa T, Fukayama M, Koike M, Tabata I, Okamoto A: A case of malignant cystic endocrine tumor of...
- 6
- 283
- 0
Báo cáo y học: "Hazards of tube thoracostomy in patients on a ventilator" doc
... separately in self- and mechanicalventilating patients along with considering the clinical settings as well as the specialty demands For instance efficient drainage of left-sided pleural effusion ... in “pre-drainage risk Consent Written informed consent was obtained from the patient for publication of this case report and accompanying images A copy of the written consent is available for ... home/assessment_sdops.aspx], Accessed on 12 December 2010 doi:10.1186/1749-8090-6-39 Cite this article as: Shaikhrezai and Zamvar: Hazards of tube thoracostomy in patients on a ventilator Journal of Cardiothoracic Surgery...
- 2
- 383
- 0
báo cáo khoa học: " Impact of welfare cheque issue days on a service for those intoxicated in public" pptx
... admissions on a given day of the welfare week and the mean daily admission number in Comparison of the mean number of SU admissions on a given day of the welfare week and the mean daily admission number ... contributions to the conception and design of the analyses, interpretation of the data and drafting of the manuscript, and they all approved the version to be published Acknowledgements Li holds a postdoctoral ... Primary Access Regional Information System (PARIS) database Ethical Approval for the study was obtained from the Behavioural Research Ethics Board of the University of British Columbia Overall,...
- 4
- 277
- 0
Báo cáo sinh học: " Survival analysis of longevity in dairy cattle on a lactation basis" ppsx
... information is added when analysing longevity on a lactation basis The trait of interest is in both cases the overall risk of failure Applications of survival analysis on a lactation basis can be found ... lactation and one for later lactations Therefore, for LACTPL, 313 Longevity on a lactation basis three alternatives were tested: a single baseline hazard function, two baseline hazard functions ... Table II Parameters from analyses of longevity based on the entire length of life (PL) and on a lactation basis (LACTPL) with stage of lactation effect partitioned at 0–10, 11–150, 151-days of...
- 14
- 321
- 0
Understanding and Using Letters of Credit part1
... for any reason, at any time by the issuing bank without notification A revocable letter of credit cannot be confirmed If a correspondent bank is engaged in a transaction that involves a revocable ... A draft is also called a bill of exchange There are two types of drafts: sight and time A sight draft is payable as soon as it is presented for payment The bank is allowed a reasonable time to ... issuing bank has a reasonable time to examine those documents The issuing bank is obligated to accept drafts and pay them at maturity Standby Letter of Credit The standby letter of credit serves a different...
- 6
- 652
- 1
Making the Paper Cut - Resumes, Cover Letters, Applications, and Letters of Reference
... information you will need to fill out the application: ● ● ● ● ● ● ● ● 78 Educational background, with dates attended and graduated, GPA, honors, and so on Professional experience, with dates and addresses ... with dates, addresses, and reasons for leaving Teaching credentials held and their expiration dates Professional references, including addresses and telephone numbers Personal information, including ... it and proofread it carefully “Pay attention to before actually submitting it As a de Never send in an ap tails precaution, we suggest making a copy pl with even one sing ication of the application,...
- 41
- 537
- 0
A discourse analysis of economic export contracts in english and vietnamese
... focusing on the language of contracts, especially economic export contracts Most of the studies are parts of books on contracts and guides to the preparation for contracts in general But the standard ... organisational, lexical and syntactic features of economic export contracts in English and Vietnamese based on the findings Chapter presents conclusion and implications of economic export contracts ... procedures for data analysis: - The data analysis was based on the quantitative and the qualitative data to point out the main layout, lexical choice and syntax of the Vietnamese and English Economic...
- 101
- 797
- 4
Tài liệu Understanding and Using Letters of Credit Part 1 pptx
... letter of credit The commercial letter of credit is the primary payment mechanism for a transaction The standby letter of credit serves as a secondary payment mechanism A bank will issue a standby ... letter of credit Standby letters of credit are issued by banks to stand behind monetary obligations, to insure the refund of advance payment, to support performance and bid obligations, and to ... correspondent bank is engaged in a transaction that involves a revocable letter of credit, it serves as the advising bank Once the documents have been presented and meet the terms and conditions...
- 9
- 511
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008