concord which was erected by a decree of the senate on the scene of these seditions and massacres
45. She was anxious because her child was kidnapped by a notorious ............... of robbers. a. pot
... ours a 11 a man tried and failed a Many b Many of c Many a d A lot of a 12 I didn’t believe them at first but in fact everything was true a they said b that they said c what they said d ... Revolution began d The beginning of the American Revolution a 19 Call an ambulance There’s been a accident b an accident c some accident d any accident b 20 The plane would have landed the ... easier a had have b had c would have d has b 16 This wet weather has lasted for a long time now rained every single day a There has b There was c It has d It was c 17 The plane land at 10.30...
- 43
- 638
- 0
Báo cáo khoa học: Netropsin interactions in the minor groove of d(GGCCAATTGG) studied by a combination of resolution enhancement and ab initio calculations pot
... calculations The netropsin amidinium end The contact area of the Nt amidinium end (NAE) was investigated by evaluating the interaction energies and hydrogen positions of the end fragment and the ... calculations of the interaction between (A) the amidinium end and bases A2 5, T8 and G9; and (B) the guanidinium end and bases A5 , T28 and A6 Intermolecular geometry constraint according to the ... [28,29,44,45] The contact area of the NAE has been studied by evaluating the effect of adenine A2 5, thymine T8, guanine G9 and one water molecule, W57, on the change of the total energy The NGE, has also...
- 11
- 483
- 0
Báo cáo hóa học: " A Novel Method to Fabricate Silicon Nanowire p–n Junctions by a Combination of Ion Implantation and in-situ Doping" docx
... KI and I2, a standard Au etchant This resulted in the reduction in the average length of the NWs to around 260 nm (Fig 1d) Before the implantations, the samples were spin coated using a spin -on- glass ... implantation of phosphorus ions at room temperature was used to obtain a rectangular dopant profile The implantation energies were 45 and 25 keV corresponding to doses of 1.3 1014 and 123 Fig The ... formed in a Si NW a An SEM image of a NW indicating the p- and n-regions b The expected phosphorus and boron profiles in the NW The P profile was simulated by TRIM code, while the B profile was taken...
- 4
- 332
- 0
Báo cáo toán học: "Permutations generated by a stack of depth 2 and an infinite stack in series" potx
... put x on A and a on B 2.1 If in the output permutation b precedes a then keep a on A and put x on B 2.2 If in the output permutation b precedes x then put x on A and a on B When none of the conditions ... case put a on B and x on A 3.2 If in the output permutation x precedes a then put a on B and x on A unless the subinterval y x is right-contiguous and avoids 312, in which case keep a on A ... no element of B contains another) then we call B the basis for the set For example, the set of permutations that avoid 12 and 123 is the set of all decreasing permutations, and its basis is simply...
- 12
- 241
- 0
Báo cáo y học: "Spontaneous Hemoperitoneum Caused By a Diverticulum of the Sigmoid Colon"
... preparation The bleeding was controlled by #3-0 Vycryl intracorporeal suture, and the invagination of the diverticulum was performed laparoscopically The recovery was uneventful, and the patient ... which makes its wall weak, as compared to the small intestine that is formed of the inner circular and outer longitudinal muscle layers The vasa recta, which supply the mucosa and submucosa of the ... In addition, the remaining colon wall was normal, but the bowel preparation was poor The invagination of diverticulum has an advantage over diverticulectomy in that it minimizes bowel leakage...
- 3
- 531
- 0
Treatment of Textile Wastewater by a Coupling of Activated Sludge Process with Membrane Separation
... consisted of an aeration tank and a microfiltration membrane as separation apparatus The aeration tank was made from Plexiglas with a working volume of liters Air was supplied to the aeration tank ... characteristics as mentioned in the wastewater preparation, was treated by the coupling of an activated sludge process and a membrane separation The backflush condition applied was that determined in the ... a disadvantage of secondary sedimentation tank is that its separation ability depends on the operating condition in aeration tanks Therefore, the performance enhancement of CASP by increasing...
- 8
- 434
- 0
Báo cáo khoa học: Nck-1 selectively modulates eIF2aSer51 phosphorylation by a subset of eIF2a-kinases docx
... well illustrated by the increased translation of the activating transcription factor (ATF4), a transcription factor that initiates a transcriptional program increasing the expression of specific ... phosphorylation of eIF2aSer51, attenuation of translation and polysomal dissociation that normally occur in response to pharmacological induction of ER stress leading to PERK activation [20] In a more ... process, which involves the phosphorylation of the a- subunit of eIF2 on Ser51, leads to the inhibition of general translation with the concomitant promotion of the translation of specific mRNAs This...
- 11
- 376
- 0
Support to woman by a companion of her choice during childbirth: a randomized controlled trial potx
... negative perception of women towards giving birth, in the use of analgesia/anesthesia, and in the frequency of instrumental vaginal delivery (forceps and vacuum extraction) and Caesarean section ... disease and/ or indication for elective Caesarean section The study was approved by the Institutional Review Board and by the director of the hospital At the time of the study for women to have a companion ... relation to cervical dilation; time of analgesia in relation to cervical dilation and time of admission to hospital; presence of functional dystocia and changes in fetal wellbeing; length of the...
- 7
- 337
- 0
Báo cáo khoa học: In vitro gamma-secretase cleavage of the Alzheimer’s amyloid precursor protein correlates to a subset of presenilin complexes and is inhibited by zinc potx
... that a separation between c-3FLAG standard and e-CTF-3FLAG was achieved in lane An uncharacterized anti-FLAG immunoreactive protein migrating between the a and c peptides was detected on long ... during chromatography, and the fact that only an aliquot of each fraction was assayed still placed the theoretical yield well within the detection limits of our assay which showed that activity ... 17 h and analysed by anti-FLAG Western blot Lanes containing the e-3FLAG standard are indicated by ‘e’ Gamma-secretase activity was detected in void volume fractions only Note that e-3FLAG production...
- 14
- 420
- 0
A survey of technology thinkers and stakeholders shows they believe the internet will continue to spread in a “flattening” and improving world. There are many, though, who think major problems will accompany technology advances by 2020 doc
... were amassed The early 1990s predictions are available in a searchable database online at the site Imagining the Internet: A History and Forecast and they are also the basis for a book by Anderson ... ForgeAhead, an information and communications consulting firm, and a leader with Information Industry of South Africa and the World Information Technology and Services Alliance, pointed out the fact ... the predictions database and more, and an ethnographic study of a small town, “One Neighborhood, One Week on the Internet,” both under the direction of Janna Quitney Anderson For contact regarding...
- 115
- 441
- 0
Báo cáo "Thermomechanical characteristics of rigid poly(vinyl chloride) crosslinked by a peroxide in the presence of trimethylolpropane trimethacrylate " pdf
... samples This is explained by the crosslinking PVC in the presence of DAPC and TMPTMA as mentioned above At any concentration of TMPTMA, a maximum of the PVC samples also appears at 0.4 phr of ... g) on expansion, softening and contraction of a rigid PVC sample crosslinked by 0.4 phr of DAPC and 10 phr of TMPTMA When small loads (0.01 and 0.03 N) are used, a significant sample expansion ... - CONCLUSION For thermomechanical analysis of crosslinked rigid PVC, probe load of 0.05 N is the most suitable to observe and evaluate expansion, softening and contraction of the sample Glass...
- 5
- 377
- 0
Báo cáo hóa học: "Research Article Epileptic Seizure Prediction by a System of Particle Filter Associated with a Neural Network" doc
... the same at the next seizure onset All the features can be updated as long as the information of a new seizure is available Thus the system can adaptively update all related parameters automatically ... is a nonlinear model with Gaussian state space A local linearization technique is applied to nonlinear equations and an approximate linear equation is obtained in (16) A series of values of hidden ... waves, can be modeled by a similar Poisson process Other combinations based on delta (0–4 Hz), theta, alpha, and beta (12–30 Hz) waves are also calculated but their characteristics are not as...
- 10
- 348
- 0
Báo cáo hóa học: "Research Article The Problem of Scattering by a Mixture of Cracks and Obstacles" pptx
... 2000 J Cheng, Y C Hon, and M Yamamoto, “Conditional stability estimation for an inverse boundary problem with non-smooth boundary in R3 ,” Transactions of the American Mathematical Society, vol ... having an open crack Γ and a bounded domain D in R2 as cross section We assume that the cylinder is possibly partially coated on one side by a material with surface impedance λ This corresponds ... problem and reformulate the problem as a boundary integral system by using single- and double-layer potentials The existence and uniqueness of a solution to the corresponding boundary integral system...
- 19
- 271
- 0
Báo cáo khoa học: "Stomatal and non stomatal limitation of photosynthesis by leaf water deficits in three oak species: a comparison of gas exchange and chlorophyll a fluorescence data" potx
... higher rate initial values, but the overall evolution was Alteration of (A, C) relationships showed that apparently both stomatal and non stomatal factors contributed to the limitation of A The maximal ... maximal rate of net CO assimilation at high C (A was first af) i max fected According to von Caemmerer and Farquhar (1981) and Farquhar and Sharkey (1982), this could mean a decrease in the rate of ... stream of I was provided continuously and monitored by a mass flow controller A fan homogenized the air inside the chamber CO molar fraction of the air in the chamber (C was ) a controlled by injecting...
- 16
- 231
- 0
Báo cáo y học: "Mitral valve surgery for mitral regurgitation caused by Libman-Sacks endocarditis: a report of four cases and a systematic review of the literature" pptx
... characterized by fibrin deposits at various stages of fibroblastic organization, neovascularization, occasional haematoxylin bodies, and by a variable extent of inflammation with mononuclear ... neovascularization at the base of the vegetation The vegetation consists of fibrin-platelet thrombi and shows signs of acute and chronic inflammation with neutrophil and mononuclear cell infiltration (C) ... stain of the atrial surface of the excised mitral valve anterior leaflet Orginal magnification × 25 (B) Magnified section of A Original magnification × 400 Fibrinoid changes and neovascularization...
- 13
- 584
- 0
Báo cáo y học: " Eradication of intractable malignant ascites by abdominocentesis, reinfusion of concentrated ascites, and adoptive immunotherapy with dendritic cells and activated killer cells in a patient with recurrent lung cancer: a case report" pps
... cells on day Drainage and intraperitoneal immunotherapy in the hypogastric area continued for month A total of 13,222 ml of ascites was aspirated Black bars indicate the volume of ascites, and ... ascites and transferred 9.8 × 109 DC+AK cells on day Drainage and intraperitoneal immunotherapy in the epigastric area continued for month A total of 6000 ml of ascites was aspirated Black bars ... medium was added at the termination of incubation, centrifuged at 900 g for 10 minutes and the radioactivity of the supernatant was examined with a gamma counter (Auto-well Gamma System; ARC-370, Aloka,...
- 7
- 282
- 0
báo cáo khoa học: " Use of the femoral vein (''''groin injecting'''') by a sample of needle exchange clients in Bristol, UK" ppt
... their groin The study was reviewed and approved by the BDP management board The interview was conducted after the needle exchange transaction was completed Verbal consent was obtained Data was ... staffed by the interviewer were invited to take part in the study Participants were guaranteed strict confidentiality and data was collected anonymously Data collection Data was gathered using a short ... questionnaire was developed on the basis of discussion between the two authors and staff at BDP JM, who is employed by BDP, conducted the interviews JS entered and analysed all the data and drafted the...
- 5
- 432
- 0
Báo cáo y học: "Inhibitory effects on HAV IRES-mediated translation and replication by a combination of amantadine and interferon-alpha" doc
... amantadine and IFN-alpha Suppression effects at 48 h after transfection by the combination of amantadine and IFN-alpha against HAV replication were stronger than those by amantadine or IFN-alpha ... HAV IRES mediated-translation and other mechanisms and that, on the other hand, amantadine suppresses HAV replication mainly through HAV IRES mediated-translation There are several reports concerning ... is the first study demonstrating that a combination of amantadine and IFN-alpha can suppress HAV replication more effectively than amantadine or IFN-alpha alone Abbreviations HAV: hepatitis A...
- 5
- 301
- 0
báo cáo khoa học: " Potential chromosomal introgression barriers revealed by linkage analysis in a hybrid of Pinus massoniana and P. hwangshanensis" ppsx
... Parapatric speciation is one of the evolutionary processes underlying speciation Then grass species Anthoxanthum has been known to undergo parapatric speciation as mine contamination of an area, which ... was conducted by MapMaker version 3.0 [28], and map construction was described as in Yin et al [19] Map charts were drawn with the program of MapChart 2.1 [29] Genome coverage was estimated by ... Chi-square value of 0.00; horizontal bars on each linkage group are used to indicate the position, the distortion direction, and the distortion intensity of the mapped markers; horizontal bars at the...
- 7
- 277
- 0
Báo cáo khoa học: "Septic shock is correlated with asymmetrical dimethyl arginine levels, which may be influenced by a polymorphism in the dimethylarginine dimethylaminohydrolase II gene: a prospective observational study" docx
... Primer Allele GAAGGTGACCAAGTTCATGCTGACTGGAAGTCCAGCCCGG Allele GAAGGTCGGAGTCAACGGATTGACTGGAAGTCCAGCCCGC Common CCAGCTTTCTCCTTCTGTCCCATAA Table Demographics and asymmetrical dimethyl arginine (ADMA) ... participated in the design of the study, patient recruitment, data and sample collection, ELISA and DNA analysis, statistical analysis, and drafting of the manuscript FD and VC participated in the ADMA ... cardiovascular failure, a non-cardiac organ failure score was obtained by excluding the cardiovascular component from the total SOFA score There was a positive correlation between this score and...
- 7
- 265
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25