comp give three characteristic features of the osteochondrodysplasia for which a mutation in its gene is responsible
Báo cáo hóa học: " Prevalence of the GJB2 IVS1+1G A mutation in Chinese hearing loss patients with monoallelic pathogenic mutation in the coding region of GJB2" pot
... found in this study In three of the compound heterozygotes carrying IVS1+1G >A and pathogenic mutation in the exon of GJB2, the separate segregation of each allele was confirmed in either the parents ... one pathogenic mutation in GJB2 [40] and 23.40% of Hungarian patients carrying a mutation in only one allele of the coding region of the GJB2 gene [41] It is also lower than the value of 4.6% among ... reported a GJB2 mutation, -3438C>T, located in the basal promoter of the gene, in trans with V84M, in a patient with profound hearing impairment They verified that the -3438C>T mutation can abolish the...
- 7
- 695
- 0
Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx
... 5¢-TTCACGATTGAACAGGTAAACAAAATTTTCC CTTTTTAGAACGACATGCAGCTGAAGCTTCGTA CGC-3¢ and disRAS1rev CAAAACCATGTCATAT CAAGAGAGCAGGATCATTTTCAACAAATTATGC ATAGGCCACTAGGGATCTG-3¢ YEp351-SUT2 was constructed to contain SUT2 as the ... yeast/info/tools/hegemann/gfp.html) using the primers SUT-GFPfwd 5¢-GACTGTCGATGATTATGGTTGCC CGCTGGCTTCCAAACCCTTATCGATACCGTCGA CCC-3¢ and SUT-GFPrev 5¢-AACAATTTCACACACA GGAAACAGCTATGACCATGATTACGCTATAGG GCGAATTGGGTA-3¢, respectively ... The cassette was amplified from the plasmid pUG27 [13] using the primers disSUT2fwd 5¢-TGACGCTCACCAAGCTATTGGTTT GTTTGGATCAATCGTCAGATATGAAGGCATAG GCCACTAGTGGATCTG-3¢ and disSUT2rev 5¢-TAT TAATATTCCTATATTTTACATAGGAGGAAATTA...
- 8
- 485
- 0
báo cáo hóa học:" Multiple functions of the von Willebrand Factor A domain in matrilins: secretion, assembly, and proteolysis" ppt
... T7, amplifying inserts from pCDNA3.1 Adding a flag tag TAA TAC GAC TCA CTA TAG GG AAG GAC GAT GAT GAC AAA GCT GCA AAT ACA TGT GCA CT TGT CAT CAT CGT CCT TAT AGT CCC CCC AGA CTC CAC AGC T GAG GAG ... AGC AGT AAA GAA CAA CCT GGG TGG CAG TCA TGA TCA TGA CTG CCA CCC AGG TGG TTC TTT GAT GAC AAA GCA CCT CCT CAG CCC AGA ATC TTC CTC ACT GCA GGT CTT CCC ATC ATT ACC TGC AGT GAG GAA GAT CCA TGC GAA TGT ... immunoprecipitation with an antibody against the V5 tag of the recombinant matrilin-3 Equal protein amount was loaded in each lane of the SDS-PAGE gel for autoradiogram analysis E Autoradiograph of recombinant...
- 13
- 382
- 0
Presented in Partial Fulfillment of the Requirements for graduation with distinction in Economicsin the College of Social and Behavioral Sciencesat The Ohio State University
... it can be argued that this is the result of increasing crime rates, there was no major growth in criminal law during this period Putnam states that the largest increase in demand for legal work ... that our measure of social capital can overstate the actual level of social capital and hence inflate our results Therefore, if we find statistically significant results in favor of a social capital ... coefficients as representing the change in the dependent variable (in this case final income) given the change in one of the independent variables—holding the rest of the independent variables constant—...
- 71
- 318
- 0
Báo cáo y học: " Psychological response of family members of patients hospitalised for influenza A/H1N1 in Oaxaca, Mexico" pdf
... more acute The finding that increasing age is associated with increasing death anxiety is also an interesting finding The generally accepted relationship between age and death anxiety is that death ... levels had accelerated in the States of Nuevo León, Baja California, Sinaloa in Mexico City, Tlaxcala and Oaxaca At the time of the study, Mexico had experienced three peaks in infection rates; the ... manuscript, assisted with analysis and interpretation of the data, and is the corresponding author, KA conducted the statistical analysis, and contributed to the data interpretation and draft manuscript...
- 9
- 310
- 0
A STUDY OF LINGUISTIC FEATURES OF THE NAMES OF COFFEE SHOPS IN ENGLISH VERSUS VIETNAMESE
... structural and semantic features 3.6 DATA ANALYSIS After completing the data collection, analyzing and classifying data are the next steps The researcher will employ to analyze and classify the data ... understand and gain a good insight into the cultural, historical features of the native places contained in the names of coffee shops On the other hand, the result of the study will give a chance for ... with analyzing structural features, i.e morphological and syntactic features as well as semantic features; then, on the basis of analyzed semantic features, cultural features of these names are...
- 43
- 1,017
- 0
A study of semantic and pragmatic features of the adjective warm and its vietnamese equivalents
... impose the use of the native meaning of the adjective Warm, he should ask himself whether the language on the target language In fact, the two languages can not meaning in a certain case is clear ... Making an investigation of some semantic and pragmatic features of the adjective Warm in English and its equivalents in Vietnamese - Analyzing meanings of the adjective Warm in particular contexts, ... studied in a precise and systematic way by means of componential analysis of which the theory of semantic field greatly leans 2.2.1.5 Semantic features Semantic more similar meanings features play a...
- 13
- 865
- 0
A discourse anslysis of the linguistic features of the advertisements of food and drink in english versus vietnamese
... Some Characteristics of Advertising Discourse Advertisements as a genre have their distinctive linguistic features which are manifested in the manipulation of language for the sake of informing and ... being exposed to the advertisements of food and drink as far as the language acquisition and skill training are concerned I have decided to carry out a discourse analysis of the What are the linguistic ... Discourse Analysis -The Socio-linguistic Analysis of In English, in A Discussion Concerning Linguistic Units and Natural Language by Stubbs, M., “An Introduction to Discourse Meaning in English Language...
- 13
- 1,535
- 1
A contrastive analysis of linguistic features of the adjective black in english and đen in vietnamese
... addition, the source of data as well as data analysis are also mentioned And in Chapter Four the findings of the research on the semantic and pragmatic features of the adjectives Black and Đen are ... using a statistical package for the same tasks 11 12 CHAPTER METHODOLOGY AND PROCEDURES - Examining the pragmatic features of the adjectives Black and Đen - Giving contrastive analysis of Black and ... FINDINGS CONTRASTIVE ANALYSIS OF LINGUISTIC FEATURES OF THE ADJECTIVE "BLACK" IN ENGLISH AND "ĐEN" IN VIETNAMESE k Marked by disaster or misfortune: black areas of drought; Black Friday wearing...
- 13
- 1,921
- 5
A contrastive analysis of semantic and pragmatic features of the words denoting birds in english and vietnamese
... fields as well as pragmatic features of the WDBs The finding of the pragmatic features of the WDBs leads both teachers and learners of study may be in one way or another beneficial to the language ... and comparative analysis of the language matter can be 5.2 IMPLICATIONS FOR TEACHING, LEARNING AND recommended Method of this kind will make it easy for teachers to TRANSLATION diagnose and also ... denotation is a part of the According to Crystal [3, p.346-347], semantic field is defined meaning of a word or phrase that relates it to phenomena in the real as the view that vocabulary of a language...
- 13
- 1,702
- 5
Tài liệu Báo cáo Y học: Proteolysis of bovine b-lactoglobulin during thermal treatment in subdenaturing conditions highlights some structural features of the temperature-modified protein and yields fragments with low immunoreactivity pptx
... at 10 s per scan Mass scale calibration was carried out using the multiple-charged ions of a separate introduction of myoglobin Mass values are reported as average masses Quantitative analysis ... in Materials and methods) confirm that the accessibility of cleavage sites on the substrate, rather than the intrinsic catalytic ability of a given protease, is what limits the effectiveness of ... to a final mass ratio enzyme/BLG of : 20 or of : 10 The protein/protease mixture was then placed in a thermostatted water bath for the required amount of time At the end of the heat treatment the...
- 11
- 526
- 0
Báo cáo khoa học: Covalent and three-dimensional structure of the cyclodextrinase from Flavobacterium sp. no. 92 pdf
... positions of the N-terminal domains and the differences in domain B near Ca-I (right) are clearly visible The chain fold of the N-terminal domain of CDase is similar to that of the related CD-degrading ... ThMA and BaCD nor in the majority of a- amylases Ca-II is located in the loop between a1 and a2 of domain A (Fig 2) and Fig Stereoview of a ribbon plot of CDase showing the N-terminal domain (red), ... 223–282) and a C-terminal domain (domain C, 517–601) In addition, CDase contains an N-terminal domain (1–102), which assumes a characteristic b-sandwich structure composed of the antiparallel strands...
- 10
- 450
- 0
Báo cáo khoa học: Unique features of the hemoglobin system of the Antarctic notothenioid fish Gobionotothen gibberifrons ppt
... reverse-phase HPLC a- Chains Direct sequencing of intact a- chains was unsuccessful, suggesting that (as in all Antarctic fish Hbs examined so far) the N-terminal residue is blocked, therefore not available ... fluctuations during migration) requiring fine regulation of oxygen binding Finally, although in an organism biosynthesis of higher amounts of an additional Hb can be easily accomplished and may be considered ... N-terminus of the intact globin (T2) and from the internal sequence obtained after cleavage of the Asp-Pro bond (T11) T10 and T12 coeluted in the same chromatographic peak, and their sequence was...
- 7
- 417
- 0
Báo cáo khoa học: Enzymatic features of the glucose metabolism in tumor cells ppt
... a set of key proteins involved in the stabilization of the genome and the regulation of cell proliferation and apoptosis, the transformation into a malignant cell type is accomplished A persistently ... ALD A being the predominant isoform [91] and thus being a candidate for a tumor marker [92] Intriguingly, glyceraldehyde 3-phosphate, the reaction product of ALD, has been characterized as an anti-apoptotic ... Nagashima Y, Tanaka T, Yamamoto S, Oka M & Nakamura K (2009) Detection of autoantibodies against cyclophilin A and triosephosphate isomerase in sera from breast cancer patients by proteomic analysis...
- 24
- 454
- 0
Báo cáo khoa học: Mercury(II) binding to metallothioneins Variables governing the formation and structural features of the mammalian Hg-MT species pptx
... titrations at acidic pH values provide information on the binding of Hg(II) to the corresponding apo-MT form [23] In addition, comparison of the two sets of data gives an indication of the role of ... X after the formation of Hg7-bMT Comparison of the three sets of CD data indicates that the degree of chirality of the Hg-bMT species is generally independent of t However, the chirality of the ... pathways shown in Scheme Comparative analysis of the three sets of data indicates that the stoichiometry of the species formed along the three titrations at pH depends on neither the stabilization time,...
- 9
- 396
- 0
Đề tài " Determination of the algebraic relations among special Γ-values in positive characteristic " pdf
... obtaining rigid analytic trivializations is more elementary than that of [Si a] because the explicit formulas for Coleman functions at our disposal obviate sophisticated apparatus from rigid analysis ... function field situation For a discussion of the latter, see [BaGeKaYi] For a simple example in the case q = 3, which was in fact discovered before all the others mentioned in this paragraph, see [Si ... Annals of Mathematics, 160 (2004), 237–313 Determination of the algebraic relations among special Γ-values in positive characteristic By Greg W Anderson, W Dale Brownawell∗ , and Matthew A Papanikolas...
- 78
- 267
- 0
Báo cáo khoa học: Variants of b2-microglobulin cleaved at lysine-58 retain the main conformational features of the native protein but are more conformationally heterogeneous and unstable at physiological temperature potx
... (Italy), for the use of their 800 MHz NMR facility References Gejyo F, Yamada T, Odani S, Nakagawa Y, Arakawa M, Kunitomoto T, Kataoka H, Suzuki M, Hirasawa Y & Shirahama T (1985) A new form of ... contained 0.2 mgÆmL)1 of a marker peptide Shown are the summed peak areas P (total area of f + s peaks) divided by the marker peak area M at different time points as a percentage of the initial value ... marking b2m for clearance in the circulation and possibly failing in amyloidosis In any case, the results reported here provide a further basis for understanding the link between in vivo stability...
- 14
- 358
- 0
báo cáo hóa học: " Characteristic values of the lumbar load of manual patient handling for the application in workers’ compensation procedures" pot
... medically, occupationally and socially In addition, the consequences of accidents and diseases are financially compensated for Mainly diseases which are listed in the Occupational Diseases Regulation ... this article as: Jordan et al.: Characteristic values of the lumbar load of manual patient handling for the application in workers’ compensation procedures Journal of Occupational Medicine and ... as the main components of the system consisting of three infrared cameras each which are arranged in a firm angle and distance to each other, are required to determine the 3-D position of each...
- 13
- 392
- 0
Báo cáo nghiên cứu khoa học: " AN APPROACH TO THREE CLASSICAL TESTS OF THE GENERAL THEORY OF RELATIVITY IN THE VECTOR MODEL FOR GRAVITATIONAL FIELD" docx
... potential g0 at this point We suppose that there is every locally Minkowskian coordinate system at each point in a gravitational field This hypothesis agrees the axiom which Gauss took as the basis ... choose the length of a ruler and rate of a clock at a point O which is very distance from the field source, say l0 and 0, as a standard etalon The gravitational potential is the cosmic background ... basis of non-Euclidean geometry Gauss assumed that at any point on a curved surface we may erect a locally Cartesian coordinate system in which distances obey the law of Pythagoras This hypothesis...
- 7
- 461
- 1
Báo cáo toán học: "hains, Subwords, and Fillings: Strong Equivalence of Three Definitions of the Bruhat Order" potx
... n; In each row, the labels are weakly decreasing; In each column, the labels are distinct The standard filling of T (v) is a labeling of the boxes of T (v) such that all boxes on row k are labeled ... presentation of the paper The paper has been finalized while the author has been visiting the University of Massachusetts Boston, and he thanks the Department of Mathematics for their hospitality ... the computation of generators in the equivariant cohomology ring of flag varieties A more detailed presentation will be given in a forthcoming paper Let M = F ln (C) be the variety of complete flags...
- 13
- 151
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25