communicate the results in a fashion that portrays the relative risks and uncertainty in a response to the management goals
Regional Scale Ecological Risk Assessment - Chapter 2 potx
... adaptive management of risk Step 10 Communicate the Results in a Fashion that Portrays the Relative Risks and Uncertainty in a Response to the Management Goals The risk assessment process, no matter ... laboratory investigation to reduce uncertainties and to confirm the risk rankings Test the hypotheses listed in Step 10 Communicate the results in a fashion that portrays the relative risks and uncertainty ... for the region What you care about and where? Make a map Include potential sources and habitats relevant to the management goals Break the map into regions based upon a combination of management...
- 25
- 249
- 0
Tài liệu Exporting the Results of a Query to an Array pdf
... from the table dt The DataTable to convert to the array rowCount The number of rows to export to the array startRow The row number of the first row to export fields A string array containing the ... Object[][] tableArray = GetRows(DataTable dt, Integer rowCount, Integer startRow, String[] colName); Parameters tableArray Returns an array of field values corresponding to the values in the columns and ... = Math.Min(nRows, rowCount); // Create an object array to hold the data in the table Array a = Array.CreateInstance(typeof(object), nRows, nCols); // Iterate over the collection of rows in the...
- 5
- 309
- 0
Báo cáo hóa học: "Clinically important improvement in the WOMAC and predictor factors for response to non-specific non-steroidal anti-inflammatory drugs in osteoarthritic patients: a prospective study" docx
... fadouaallali@yahoo.fr Latifa Tahiri,Aff1 Email: latifatahiri@yahoo.fr Hamza Khazzani,Aff1 Email: hamzakhazzani@yahoo.fr Leila El Mansouri,Aff1 Email: la_mansouri1@yahoo.fr Sanae Ali Ou Alla,Aff1 ... Alla,Aff1 Email: sanae.alioualla@yahoo.fr Redouane Abouqal,Aff2 Email: abouqal@invivo.edu Najia Hajjaj-Hassouni,Aff1 Aff2 Email: n.hajjaj@medramo.ac.ma Aff1 Laboratory of Information and Research on ... conceived the study and supervised its design, execution, and analysis and participated in the drafting and critical review of the manuscript IH, FA and RA did data management and statistical analyses...
- 22
- 392
- 0
The Future of Justification: A Response to N. T. Wright pptx
... from sin and its effects The point of election always was that humans were sinful, that the world was lapsing back into chaos, and that God was going to mount a rescue operation That is what the ... [of a covenant people] always was that humans were sinful, that the world was lapsing back into chaos, and that God was going to mount a rescue operation That is what the covenant was designed to ... sinner is also in the family and that only justified sinners are in the family, and that being in the family is an implication of being justified But to say that justification was about who was...
- 240
- 1,101
- 0
Báo cáo khoa học: "A Response to the Need for Summary Responses" pdf
... implications if the interactions with a database management system are to have the properties and constraints normally associated with human dialogue Interactions with traditional database management ... performance enhancement, the knowledge base may be augmented with an additional component for storing away the results of the preceding database interactions to obviate the need to search the database ... frame corresponds to an attribute in the relations in the database In addition to a description of the attributes, these frames indicate the nature and range of the attribute's potential values...
- 5
- 430
- 0
báo cáo hóa học:" A decade of modelling research yields considerable evidence for the importance of concurrency: a response to Sawers and Stillwaggon" potx
... questions needed to be answered to allow these tools to handle longitudinal data and dynamic network simulations, as well as to use sampled and incomplete data to parameterize, model and simulate complete ... biological and behavioural data Since Morris and Kretzschmar had Following the Morris and Kretzschmar papers, a large multi-disciplinary group of statisticians and social scientists took the approach ... itself to analytical exploration in ways that stochastic simulation methods not, a quality that has long been highly valued in modelling Thus, around the same time as, and subsequent to, the initial...
- 7
- 459
- 0
Báo cáo y học: "Decreased metalloproteinase production as a response to mechanical pressure in human cartilage: a mechanism for homeostatic regulatio" pps
... Figure Analysis of aggrecan and type II collagen in OF and OA cartilage Ratio II collagen in OF and OA cartilage of aggrecan to type II collagen in the cartilage matrix of OA and OF femoral heads and ... minimum (IP) mechanical load areas were obtained from each femoral head The horizontal bar indicates the median, the box is the interquartile range, and the vertical lines indicate the atypical ... results are relative to a certain sample pertaining to the experiment Separated maximum (SP) and minimum (IP) mechanical load areas were obtained from each femoral head The horizontal bar shows the...
- 11
- 520
- 0
Báo cáo y học: "Collagen-induced arthritis in C57BL/6 mice is associated with a robust and sustained T-cell response to type II collagen" pot
... provides many factors that are able to break tolerance via activation of Toll-like receptors The therapeutic profile of CIA in the B6 mouse was similar to that of RA, with a therapeutic action of ... models, hind paws were fixed, sectioned, and stained with haematoxylin and eosin In the early stages of CIA, inflammatory infiltrates were found in both the DBA/1 (Figure 2a) and B6 (Figure 2b) joints ... swelling and a more gradual increase in clinical score Histological assessment of the hind paws from arthritic DBA/1 and B6 mice revealed that, in early arthritis (up to weeks after onset), there...
- 8
- 372
- 0
Báo cáo y học: "Differences between children and adolescents in treatment response to atomoxetine and the correlation between health-related quality of life and Attention Deficit/Hyperactivity Disorder core symptoms: Meta-analysis of five atomoxetine tria
... relevant impairments were found in the Risk Avoidance and Achievement domains (and in their subdomains), in the Emotional Comfort and in the Satisfaction with Self sub-domains as well as Family involvement ... domain and subdomains Our findings regarding the low and moderate correlations between core symptoms and HR-QoL (and the small correlations found in several instances regarding change from baseline ... well-being of these children and adolescents and takes into account their autonomy as individuals [45] An additional limitation that introduces a difficulty in interpreting our results is that HR-QoL...
- 15
- 739
- 0
INVESTING IN REPRODUCTIVE HEALTH TO ACHIEVE DEVELOPMENT GOALS pptx
... Morocco, Oman, Qatar, Saudi Arabia, Syria, Turkey, the United Arab Emirates, the West Bank and Gaza, and Yemen Millennium Project, Investing in Development: A Practical Plan to Achieve the Millennium ... in the Middle East and North Africa (October 2003) Women’s Reproductive Health in the Middle East and North Africa (February 2003) Finding the Balance: Water Scarcity and Population Demand in the ... behaviors have meant that there are they are not using a family planning method few programs and relatively little information to These women are referred to as having unmet address the needs...
- 8
- 416
- 0
A Guide to Clinical Management and Public Health Response for Hand, Foot and Mouth Disease (HFMD) doc
... conducted in mainland China, Malaysia, Singapore and Taiwan (China) have been useful in improving understanding of the pathogenesis of severe disease and the underlying pathological insult leading to ... subgenogroup C4 caused major outbreaks in 2008 and 2009 (23, 24) That subgenogroup was sampled in China and Japan in the late 1990s and early 2000s and was dominant in Taiwan (China) in 2004 and 2005 ... A Guide to Clinical Management and Public Health Response for Hand, Foot and Mouth Disease (HFMD) WHO Library Cataloguing in Publication Data A Guide to clinical management and public health...
- 71
- 774
- 0
A guide to project management Frank Heyworth potx
... co-ordinators The 32 member states of the Enlarged Partial Agreement of the ECML are: Albania, Andorra, Armenia, Austria, Bosnia and Herzegovina, Bulgaria, Croatia, Cyprus, Czech Republic, Estonia, ... Approaches to project evaluation What indicators are planned to measure the effect of the project? Are the indicators qualitative or quantitative? ● Improved results in standard tests or examinations ... Comments What’s the title of the project? What are the aims of the project? State these as accurately and specifically as you can There is often a temptation to try and several things at the same time,...
- 48
- 513
- 0
Báo cáo y học: "Role of Genetic Polymorphisms in Therapeutic Response to Anti-Asthma Therapy" pot
... administration of salmeterol These findings appear to indicate that the SNP effect was limited to SABAs only, until a recent publication by Weschsler and colleagues indicated that long-acting b agonists ... however, as a study by Kedda and colleagues was unable to demonstrate a similar association.16 To attempt to understand this SNP’s association with medicine response, Sampson and colleagues examined ... appears to be a daunting task, it is a worthwhile one, as once understood, we may be able to rely on a patient’s genetics to aid in choosing the most appropriate therapy As clinicians attempting...
- 3
- 387
- 0
Báo cáo y học: "Blood autoantibody and cytokine profiles predict response to anti-tumor necrosis factor therapy in rheumatoid arthriti" pps
... SAM analysis on integrated antigen array and cytokine datasets obtained for the 29 ABCoN samples This analysis demonstrated that a panel of antigens and cytokines more effectively differentiated ... application of a multi-step proteomics approach using RA antigen arrays and cytokine arrays to discover and validate a multivariable biomarker for prediction of response to the anti-TNF therapy ... RA autoantigen microarrays [14], we expanded the number of peptide and protein autoantigens on the arrays The arrays used in the experiments described herein were 2,180-feature arrays that include...
- 13
- 299
- 0
báo cáo khoa học: "Evaluation of HER2 and p53 expression in predicting response to docetaxel-based first-line chemotherapy in advanced breast cancer" docx
... response to docetaxel-based first-line chemotherapy in advanced breast cancer Andrea Camerini1*, Sara Donati1, Paolo Viacava2, Olimpia Siclari1, Cheti Puccetti1, Gianna Tartarelli1, Chiara Valsuani1, ... Filomena De Luca2, Leonardo Martini2, Andrea Cavazzana3 and Domenico Amoroso1 Abstract Background: The human epidermal growth factor receptor (HER2) and p53 pathways may be involved in chemotherapy ... coded and the names of the patients were not revealed All available clinico-pathological data were collected and stored in an appropriate database Age, tumor grade and stage [30,31], size, histotype,(32)...
- 9
- 282
- 0
Báo cáo y học: "Role of TRPV3 in immune response to development of dermatitis" doc
... TGGCTTCCCTTTCTCAGACA GGCTACCCCCTCTCAGACAT CCAGAACAACGCAAGAAGACT TGAGAAGTTCCAATCCAGTCG TAAACGAAACAGTTCCAAGGC ATAGATGATTCAGGGATGCCC CGCAGCAAGTCTCTTATGGAA GCGACACAGCCACCTATCTC TTCATCCTAAGCACGGAGAAG TTCCCATCAGTCATCCCAAC ... ACGGTGCCCAGTCGTTTTAT ACACGGGTCACTGATACGGA AGTGTCCTTCAAACTCACCTT ATGGACAATCAGACTGCCTCA AGATAAAGGAAACCTGCCCAG GGATTCCTACCCAGCAGATTC GAAGGCTATGATGCGTCTCG AAAGGATACAGGGTCTCACGG TGGCTTCCCTTTCTCAGACA ... TTCCCATCAGTCATCCCAAC TCACTCTGAAAATCCAACCCA GCATCCTGGAAATCCTATCCT GGACAAGTTTCCAATCAGCCG AAAATGCCCTGCTAAGAAACC CAGCCTGGGAATCAGAACG BV1S 1A1 , BV2S1 BV3S 1A1 , BV4S1 BV5S1 BV2S2 BV6S 1A1 , BV7S1 BV8S1 BV8S 2A1 , 2,...
- 10
- 359
- 0
Báo cáo sinh học: " Correlations of genetic resistance of chickens to Marek’s disease viruses with vaccination protection and in vivo response to" pptx
... disease resistance and response to phytohemaglutinin The means of the swelling index measured at 24 h after injection with PHA are shown in table II The mean swelling at 48 h post injection and the ... et al (1984) that the predominant lesion in BC-1 inoculated females was in the ovary and in males in nerves The RB-1B virus induced a high proportion of visceral lesions in both males and females ... swelling was in males in 11 genetic groups and in females in 12 genetic groups The tendency was for swelling to develop more slowly and to peak later in females than in males Rank-order and product-moment...
- 13
- 205
- 0
Ethnic differences in cardiovascular response to stress role of trait anger, sex and migrant status
... reactivity to a video game challenge and to a star tracing task was also significantly predictive of subsequent ambulatory HR in African Americans and diastolic reactivity to star tracing was associated ... African American and Caucasian American normotensive adults generally report greater BP and HR responses to active coping tasks in Caucasian American relative to African American participants (Llabre, ... Psychological and cardiovascular responses to experimental harassment have also been studied among Chinese and Indian men in Singapore to examine cardiovascular reactivity as a function of trait anger In...
- 210
- 267
- 0
Báo cáo khoa học: Systemic RNAi of the cockroach vitellogenin receptor results in a phenotype similar to that of the Drosophila yolkless mutant ppt
... These included the insects D melanogaster (AAB60217), A gambiae (EAA06264), A aegypti (AAK15810), S invicta (AAP92450) and P americana (BAC02725), and the vertebrates Anguila japonica (BAB64337), ... ootheca transport Ovarian BgVgR mRNA levels appeared high at the beginning of the last nymphal instar, steadily declining along the instar, and reaching the lowest values of the instar before the ... completed using a kZapII cDNA library from B germanica adult ovaries as a template, and following a seminested PCR approach, using primers drawn from the 980 basepair fragment of the BgVgR, and kZapspecific...
- 11
- 414
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25