cleavage of app is a special case of regulated intramembrane proteolysis
Báo cáo khoa học: In vitro gamma-secretase cleavage of the Alzheimer’s amyloid precursor protein correlates to a subset of presenilin complexes and is inhibited by zinc potx
... c-secretase activity A universal characteristic of AD pathology is the post-mortem detection of Ab plaques, thus confirming the pathological relevance of c-secretase cleavage of APP Since only a small ... that allows greater detection of c-secretase activity Lastly, zinc causes structural changes in a c-secretase substrate and acts as an inhibitor of csecretase cleavage of APP Results Design of ... chymotrypsinogen (25 kDa) are indicated by arrows as a high molecular mass peak corresponding to the void volume of this column These data show that zinc can alter the apparent molecular mass of an APPderived...
- 14
- 420
- 0
Báo cáo khoa học: "When is a GIST not a GIST? A case report of synchronous metastatic gastrointestinal stromal tumor and fibromatosis" ppt
... Journal of Clinical Oncology, 2006 ASCO Annual Meeting Proceedings Part I 2006, 24:9516 Jagadeesan J, Bayat A: Transforming growth factor beta (TGFbeta) and keloid disease International Journal of ... increase in size of a dominant segment VI hepatic metastasis which was treated with radiofrequency ablation He was then maintained on imatinib at 600 mg daily with subsequent disease control Figure ... Journal of Surgical Oncology 2009, 7:8 advanced GIST, but presented with localized proliferation of soft-tissue neoplasm mimicking GIST Case presentation A previously healthy, 62 year old man was...
- 4
- 297
- 0
Báo cáo khoa học: " Is there a special mechanism behind the changes in somatic cell and polymorphonuclear leukocyte counts, and composition of milk after a single prolonged milking interval in cows" pptx
... for citation purposes) Acta Veterinaria Scandinavica 2009, 51:4 After analysis it was revealed that none of mentioned parameters had any effect on the different variables, and that only days in ... The changes in fat might at least partially be ascribed to a concentration effect FFA is undesirable in milk due to its degradation of fat quality and rancid flavour Accumulation of FFA in the ... Most of the cows were in mid Page of 10 (page number not for citation purposes) Acta Veterinaria Scandinavica 2009, 51:4 lactation and in lactation number or The herd is comparable to an average...
- 10
- 397
- 0
Báo cáo y học: "Excess circulating angiopoietin-2 is a strong predictor of mortality in critically ill medical patients"
... Minneapolis, USA) This assay measures biologically active VEGF121 and VEGF165 Statistical analysis Differences between patients and healthy controls were evaluated using a non-parametric Kruskal-Wallis test ... Critical Care Vol 12 No Kümpers et al package (SPSS Inc., Chicago, IL, USA) and the GraphPad Prism software (GraphPad Prism Software Inc San Diego, California, USA) Figure Results Decreased Ang-1 and ... optimal cut-off values Data are displayed as median and range (minimum to maximum) unless otherwise stated All statistical analyses were performed with the SPSS Page of (page number not for citation...
- 9
- 634
- 0
Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"
... 51:189-197 A ssaoui Y, Zeggwagh AA, Zekraoui A, Abidi K, Abouqal R: Validation of a behavioral pain scale in critically ill, sedated, and mechanically ventilated patients Anesth Analg 2005, 101:1470-1476 ... diagnosis of sepsis on admission to the ICU Eosinopenia may become a helpful clinical tool in ICU practices interpretation of data, and gave the final approval of the manuscript All authors read ... of data NM helped to draft the manuscript, and participated in the acquisi- Page of 10 (page number not for citation purposes) tion of data AZ participated in the coordination of the study AAZ...
- 10
- 597
- 0
Tài liệu .An ARCO Book ARCO is a registered trademark of Thomson Learning, Inc., and is used herein under pptx
... Graduate Management Admission Test, which is a standardized exam given at various locations in the United States and Canada and around the world Throughout North America and in many international ... these arguments differ from that of the stem paragraph (A) is a valid argument: Given anything that is a war, if any war is to be condemned, then all wars are to be condemned (B) is not a valid argument ... as wide of a margin as any candidate in the state’s history (A) she was reelected with as wide of a margin as any candidate in the state’s history (B) she had been reelected with as wide of a...
- 696
- 1,001
- 1
Tài liệu Organization-internal Transfer of Knowledge and the Role of Motivation: A Qualitative Case Study pptx
... technological knowledge Strategic Management Journal 23: 285–305 Miles MB 1979 Qualitative data as an attractive nuisance: the problem of analysis Administrative Science Quarterly 24: 590–601 Nonaka I ... base, a benchmarking data base, a competition, a mindset, a social ritual, gatherings etc What is the plant attitude now and how has it evolved over the years? The value of KTP? a Is KTP valuable ... plants to head of ce Each machine team sets targets annually, and follows up performance regularly Benchmarking is made feasible, and plants who want to improve performance on a particular machine...
- 12
- 514
- 0
Tài liệu Chiếu sáng trong truyền hình - Television Lighting Television is a means of changing pptx
... within a scene have the same color temperature A combination of filters and electronic adjustments is used to adapt color cameras to each new lighting situation Most cameras can adjust automatically ... or black level, of zero IRE, rather than the 7.5 IRE broadcast standard Some cameras that automatically boost the signal in low light situations can also be run in manual mode where you can control ... practice, actual contrast ranges are rarely measured using a meter A subjective analysis based on camera output is generally sufficient Color Temperature The third consideration is color temperature...
- 6
- 462
- 1
Learning english is a piece of cake 1
... English is difficult and it’s hard to memorize new words ðeɪ θɪŋk ˈɪŋ ɡlɪʃ ɪz ˈdɪfɪk əlt ænd ɪts hɑːrd tə ˈmem ə raɪz njuː wɜːdz and grammatical rules In fact, learning English can be a piece of ... ˈeɪʃ ən doʊnt ˈ wɝːɪ ə ˈbaʊt ˈɡræm ə Don’t be afraid of making mistakes Just try to speak doʊnt biː ə ˈfreɪd ʌv ˈmeɪk ɪŋ mɪ ˈsteɪk dʒʌst traɪ tuː spiːk Speak English as much as possible spiːk ˈɪŋ ... In fact, she is a sales person! “Improve” = cải thiện, cải tiến I want to improve my English! Many people are worried about learning English ˈmen i ˈpiːpl ɑːr ˈwʌrid ə ˈbaʊt ˈlɝːn ɪŋ...
- 2
- 1,669
- 15
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx
... AGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAG AGAC-3, PTI1-4 (At2g47060): 5-CCCCAAAGAAAATG AGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3 Acknowledgement This project was supported by grants from the Austrian Science ... gene as an internal standard PCRs were performed using the following primers: ACT2 (At3g18780): 5-ACATTGT GCTCAGTGGTGGA-3 and 5-CTGAGGGAAGCAAG AATGGA-3, OXI1 (At3g25250): 5-GACGAGATTATC AGATTTTACGC-3 ... Matsuoka D, Nanmori T, Sato K, Fukami Y, Kikkawa U & Yasuda T (2002) Activation of AtMEK1, an Arabidopsis mitogen-activated protein kinase kinase, in vitro and in vivo: analysis of active mutants expressed...
- 11
- 700
- 0
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf
... structure of Met8P has shown that this protein has an aspartate residue (Asp141), which is important for both chelatase and dehydrogenase function [17]; interestingly, this aspartate, Asp129, is also ... biosynthetic pathway, for example, oxidation of C17 propionate to give an acrylate side chain This type of step would normally require FAD-based chemistry Another potential dehydrogenation is NAD ⁄ NADP-dependent ... lacking iron and ⁄ or with the side chain saturated, but accessing these putative substrates is not trivial An alternative approach would be to seek accumulation of the substrate of NirF in a...
- 12
- 613
- 0
Tài liệu Báo cáo khoa học: Post-translational cleavage of recombinantly expressed nitrilase from Rhodococcus rhodochrous J1 yields a stable, active helical form ppt
... Yamashita E, Yamamoto M, Kumasaka T, Ueki T, Nanba H, Ikenaka Y, Takahashi S, Sato M et al (2000) Crystal structure of N-carbamyld-amino acid amidohydrolase with a novel catalytic framework common ... of the bar indicates the fraction assayed (B) Reducing SDS ⁄ PAGE of the active fraction showed a characteristic nitrilase band of 40 kDa The contaminating band at 60 kDa was identified as GroEL ... to amidohydrolases Structure 8, 729–737 Hashimoto H, Aoki M, Shimizu T, Nakai T, Morikawa H, Ikenaka Y, Takahashi S & Sato M (2004) Crystal Structure of C17 1A ⁄ V23 6A Mutant of N-CarbamylD-Amino...
- 10
- 450
- 0
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx
... GCGGGATCCGTGAATAATCTGCACCCTCGA ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC ... GCGAAGCTTCACGATGTCTCACACCATTT GCGGGATCCCGTTTCCCAGCCTGTTGGGCCT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC ... GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT...
- 14
- 517
- 0
Tài liệu What is a high school worth?: A model of Australian private secondary school fees docx
... program An alternative to either of these is the International Baccalaureate (IB) and a small number of schools, mainly private, offer the IB diploma Table reports some standard VCE statistics across ... (bas) It is a group of schools in Ballarat, that provides the basis for interschool sporting competition Ballarat and Clarendon College; Ballarat and Queens Anglican Grammar School; Ballarat ... English Attendance ICSEA Number of Teachers Number of Support Staff Read7 Write7 Spell7 Grammar7 Math7 School Associations: ASPV AGSV GV ACC ACOED BAS CAS Sandhurst EID GIS SIS Region: Cental East...
- 24
- 511
- 0
Tài liệu Báo cáo khoa học: Cleavage of nonphenolic b-1 diarylpropane lignin model dimers by manganese peroxidase from Phanerochaete chrysosporium Evidence for a hydrogen abstraction mechanism docx
... 4-methoxyacetophenone (III), and a- keto diarylpropane (IV) can be explained on the basis of an initial hydrogen abstraction reaction at one of two positions A benzylic radical can be generated at C1, ... apparently are oxidized solely via hydrogen abstraction mechanisms This study also shows that the a- keto-1,2-diarylpropane is oxidized via hydrogen abstraction to produce an aromatic acid and an acetophenone ... prepared for analysis as described above Chromatography and mass spectrometry GC-MS was performed at 70 eV on a Finnigan 4500 mass spectrometer using a Galaxy data system and fitted with a Hewlett...
- 9
- 496
- 1
Tài liệu Báo cáo Y học: A novel meta-cleavage dioxygenase that cleaves a carboxyl-groupsubstituted 2-aminophenol Purification and characterization of 4-amino-3-hydroxybenzoate 2,3-dioxygenase from Bordetella sp. strain 10d doc
... including those of extradiol dioxygenases available in the FASTA AND BLAST database programs at the DNA Data Bank of Japan The gene encoding 4-amino-3-hydroxybenzoate 2,3-dioxygenase is currently ... Crystallization and characterization J Biol Chem 243, 2673–2681 Murakami, S., Nakanishi, Y., Kodama, N., Takenaka, S., Shinke, R & Aoki, K (1998) Purification, characterization, and gene analysis of catechol ... Morphological and phenotypic characterization Physiological and biochemical parameters, such as Gram reaction, flagella type, catalase activity, oxidase activity and OF test, were determined using classical...
- 7
- 490
- 0
Tài liệu Báo cáo khoa học: "TREATMENT OF LONG DISTANCE DEPENDENCIES IN LFG AND TAG: FUNCTIONAL UNCERTAINTY IN LFG IS A COROLLARY IN TAG" ppt
... where sy is a string in a, or f = v and e E a The functional uncertainty approach may be characterized as a localization of the long distance dependencies; a localization at the level of fstructures ... This is the same analysis as given by LFG In a TAG, the dependent items are part of the same elementary tree Features of these nodes can be related locally within this elementary tree (as in a ... in an extended version of K-K logic (the extension consists of adding Aabstraction and application) 3 LFG AND TAG ANALYSES FOR LONG DISTANCE DEPENDENCIES We will now relate the analyses of long...
- 8
- 608
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008