chain including only dipole dipole coupling in quasistatic approximation s a maier et al adv mat 13 1501 2001
transmission line matrix (tlm) in computational mechanics - d. de cogan, et al., (crc, 2006) ww
... both analytical and numerical analysis of magnetic fields and forces, his research interests include novel numerical modeling methods and applications, especially in acoustics, mechanical-acoustic ... This is exactly analogous to mechanically oscillating systems such as a pendulum or a spring and mass, where the energy alternates between potential and kinetic 3.2.4 Transmission Line The transmission ... differential equations similar to these arises in many situations ranging from longitudinal and torsional motion of mechanical shafts to the propagation of signals on an electrical transmission line By...
- 275
- 514
- 0
core topics in neuroanaesthesia, neurointensive care - b. matta, et. al., (cambridge, 2011)
... Torcular herophili Inferior sagittal sinus Vein of Labbé Transverse sinus Sigmoid sinus Superficial Sylvian vein Basal vein of Rosenthal Sphenoparietal sinus Cavernous sinus CSF into the venous circulation ... AComA is known as the A1 segment he distal ACA has four segments named according to their location in relation to the corpus callosum, the A2 (infracallosal), A3 (pre-callosal), A4 (supracallosal) ... pain and temperature sensation Examples of intrinsic spinal cord compression include a spinal meningioma or an epidural haematoma may be weakness or sensory loss in a radicular distribution In addition,...
- 592
- 418
- 0
Innovations in Robot Mobility and Control - Srikanta Patnaik et al (Eds) Part 13 pdf
... cluster determination, in the three-dimensional information case, is not trivial In other works, the sorted two-dimensional information, from a scanner laser, is easily separated in clusters, using ... features are extracted using the Kanade-Lucas-Tomasi (KLT) feature tracking algorithm [18, 27] that automatically extracts and matches visual features from the images The second kind make use ... topological maps for a robot which uses a panoramic camera to obtain images at various locations along its path and uses the features it tracks in the images to update the its position and the map structure...
- 20
- 262
- 0
MEMS and Microstructures in Aerospace Applications - Robert Osiander et al (Eds) Part 13 pot
... electrical insulators, industrial tapes, and advanced composites This polyimide material may be dissolved readily in a number of solvents for use in various applications such as castings and coatings ... in modern MEMS packaging materials All nonmetallic materials should be selected for low outgassing characteristics and baked out in meeting their outgassing requirements The thermal vacuum bake ... during these operations To prevent contaminants, materials with a less potential of generating particles should be chosen for fabricating MEMS devices Besides particles, material outgassing as a...
- 11
- 256
- 0
Tài liệu The Bitter Chain of Slavery'''': Reflections on Slavery in Ancient Rome pdf
... Roman slavery was a complex institution, full of paradox and contrast, allowing a poet such as Martial (as I noted) to speak almost simultaneously of certain slaves by name, as individual persons, ... Tables to Justininian 's Digest, physical punishment was always assumed to be a natural and desirable way of exacting redress for criminal activity, especially for those of low social status, for whom ... Greek and Roman slaveowners had used and drawn on for centuries past His remarks nonetheless are striking Salvian was writing at a very late date in classical history, and while directed to Romans...
- 13
- 641
- 0
Báo cáo khóa học: Assembly of the silk fibroin elementary unit in endoplasmic reticulum and a role of L-chain for protection of a1,2-mannose residues in N-linked oligosaccharide chains of fibrohexamerin/P25 ppt
... 2, lanes 1–4 and 5–8) These results suggest that the 30-kDa fhx/P25 contains terminal a1 ,2-mannose residues in their N-linked oligosaccharide chains, whereas such mannose residues are absent in ... National Institute of Agrobiological Sciences, Tsukuba, Japan and their larvae were reared in the authors’ laboratories (Tohoku University and National Institute of Agrobiological Sciences) The ... remains to be elucidated We would like to speculate that fhx/P25 molecules having N-linked oligosaccharide chains interact noncovalently with nascent H-chains, perhaps during their translation and...
- 11
- 552
- 0
icimod pro poor value chain development for high value products in mountain regions indian bay leaf
... countries of the Hindu Kush-Himalayas – Afghanistan, Bangladesh, Bhutan, China, India, Myanmar, Nepal, and Pakistan – and based in Kathmandu, Nepal Globalisation and climate change have an increasing ... and Jajarkot (Pandit et al 2004) In India, bay leaf is found in the sub-tropical Himalayan states of Himachal Pradesh and Uttarakhand, the Khasi and Jaintia Hills in North East India, Jammu and ... 3: Issues, upgrading strategies, actions, and action points in the bay leaf value chains Critical issues Upgrading strategy Action Action point Lack of value chain understanding and inequitable...
- 28
- 376
- 0
icimod pro poor value chain development for high value products in mountain regions indian bay leaf 2
... countries of the Hindu Kush-Himalayas – Afghanistan, Bangladesh, Bhutan, China, India, Myanmar, Nepal, and Pakistan – and based in Kathmandu, Nepal Globalisation and climate change have an increasing ... and Jajarkot (Pandit et al 2004) In India, bay leaf is found in the sub-tropical Himalayan states of Himachal Pradesh and Uttarakhand, the Khasi and Jaintia Hills in North East India, Jammu and ... 3: Issues, upgrading strategies, actions, and action points in the bay leaf value chains Critical issues Upgrading strategy Action Action point Lack of value chain understanding and inequitable...
- 28
- 310
- 0
Báo cáo sinh học: " Liaison amid disorder: non-native interactions may underpin long-range coupling in proteins" ppsx
... (ΔΔGint < 0) or destabilized (ΔΔGint > 0) by coupling Energetic coupling may also be estimated using a bioinformatics approach based on evolutionary assumptions This indirect method has also identified ... thus a parameter for native specificity As the strength of favorable non-native interactions decreases with increasing s, the associated long-range coupling diminishes Could all non-native interactions ... computational tractability, lattice models can clarify the logic between assumptions and testable consequences, generate new hypotheses, and ask ‘what if’ questions to advance conceptual understanding...
- 5
- 171
- 0
Báo cáo y học: " Coupling of receptor interference and a hostdependent post-binding entry deficiency in a gammaretroviral envelope protein" doc
... as a defense against polytropic viruses (e.g a xenotropic provirus confers resistance to polytropic viruses in Mus castaneus [25]) Interestingly, the endogenous viral envelope that causes resistance ... twice in PBS with 2% serum and suspended in a 1% formalin solution and analyzed by a Becton Dickinson FACSCalibur cytometer Virus binding assay Virions were concentrated on a Centricon Plus-80 ... possibility is a direct binding of VR3 to Xpr1 In this case, either this interaction is not essential for successful infection of murine cells or VR3 loops containing arginine and threonine can...
- 7
- 212
- 0
Báo cáo y học: "Activation and detection of HTLV-I Tax-specific CTLs by Epitope expressing Single-Chain Trimers of MHC Class I in a rat model" pptx
... 12 13 Statistical analysis Comparisons between individual data points were made using a Student 's t-test Two-sided P values < 0.05 were considered statistically significant Competing interests ... GCCGGGACACGGCGA Sense Primer ATTCAGAAAACTC CCCAAATTCAAG TGTAC GGAGGTGGCGGGTCCATTC GGCCGCCCTGGCCCCG AGAAAA ACCCAGACCCGCGCG CTCCCCAAATTCAAG CACAGTTTTAATTGT GGAGGGGAATTTGGA GGTGGCGGGTCCGGA GGTGGCGGGTCCGGA ... A, Tanosaki R, Hanabuchi S, Masuda M, Ohashi T, Fukui F, Hasegawa A, Masuda T, Takaue Y, Okamura J, Kannagi M: Graft-versus-Tax response in adult T-cell leukemia patients after hematopoietic stem...
- 16
- 271
- 0
Báo cáo y học: "Both TRIM5α and TRIMCyp have only weak antiviral activity in canine D17 cells" ppsx
... 5'GACGACGGCAACTACAAGAC and GFPas, 5'-TCGTCCATGCCGAGAGTGAT PCR products were separated on a 2% agarose-TAE gel, and revealed with ethidium bromide staining For real-time PCR analysis, µl of each DNA preparation ... increase in soluble CA Thus, it remains possible that incoming retroviral cores are not disassembled faster under TRIM5α/TRIMCyp restriction but instead are specifically targeted to a degradation ... This saturation step was followed by incubation with an antibody against FLAG (M2 mouse monoclonal; Sigma) at a 1:400 dilution in PBS with 10% normal goat serum Fluorescent staining was done using...
- 11
- 272
- 0
Studies of quantum spin chain dynamics and their potential applications in quantum information
... dimensional quantum spin systems called spin chains is one such class In this thesis, we investigate the dynamics of spin chains from the perspective of quantum information processing In particular, ... of spin-spin interaction, spin chains can be classified into three types: Heisenberg spin chain, XY spin chain and Ising spin chain In the following, we will describe each of the spin chains in ... the spin chain and its potential advantages in the context of quantum information processing 11 1.5 Spin chain Spins are systems endowed with tiny quantized magnetic moments Bulk materials usually...
- 156
- 278
- 0
The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System
... process operating within a task; its only physical attribute is its processing state (e.g., program counter and registers) All threads within a task share the address space and capabilities of that ... resources accessible through message passing This form of external memory management allows the advantages of a single level store to be made available to ordinary user-state servers The Mach external ... data objects Messages may contain port capabilities or imbedded pointers as long as they are properly typed A single message may transfer up to the entire address space of a task msg_send(message,...
- 23
- 1,290
- 1
Phosphate removal from aqueous solutions using red mud wasted in bauxite Bayer's process
... was obtained from a bauxite ore refinery in Guinea It was analyzed using Emission Spectral Analyser PGS-2 Q24 Carl Zeiss Jena, Atomic Absorption Spectrometer Perkin Elmer 370, and M6ssbauer Spectrometer ... Orthophosphates when reacted with metals give solid metal orthophosphates, they also take part in reactions of complexation and sorptive reactions on the surfaces Polyphosphates not form compounds ... mud as a coagulant and the physiological effects of its use as well [3-5] Weaver and Ritchie have compared lime-based materials and red mud for phosphorus removal from piggery wastewaters [6] According...
- 10
- 661
- 0
Immobilization of heavy metals in sediment dredged from a seaport by iron bearing materials
... health, 2/3 of all hospitals have not applied safety waste disposal methods Most wastes have not been classified and disinfected before discharging Store houses are non-standard, unsanitary and ... cloths Sharp waste Unsharp wastes Group assignment Solutions for medical wastes in Vietnam Public economics Extremely infectious wastes Surgical wastes 1.2.1 Hazardous chemical wastes ... except hospitals which has Group assignment Solutions for medical wastes in Vietnam Public economics had manual incinerator In other hospitals, the manual incinerator is burned and leaves an uncomfortable...
- 10
- 722
- 0
Intelligent Software Agents on the Internet: an inventory of currently offered functionality in the information society & a prediction of (near-)future developments
... this reason, the Softbot supplies a forms-based graphical user interface and automatically translates forms into the logical goal language Natural language input, an alternative approach pursued ... Dataquest Inc Using agents when looking for information has certain advantages compared to current methods, such as using a search engine: Search Engine feature: Although search engines are a ... complex systems such as the Internet, but also to computers in general By means of such things as animated characters, computers and all kinds of other systems are given a more human appearance This...
- 100
- 811
- 3
Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"
... cows and herds, so as to be able to create meaningful data valid in large scale analyses (across herds and veterinary practices) Such veterinarians would generally want to focus on possibilities ... different settings, and enable researchers to take into account additional variables in subsequent analyses Our study shows that variation and bias in field data (records of metritis scores and metritis ... following situations in a herd (e.g scoring a cow and initiating a metritis treatment), would you please elaborate on that specific situation?' Data Analysis The qualitative analysis is based on a...
- 10
- 587
- 0
Báo cáo y học: "Two-year Outcome of Turkish Patients Treated with Zotarolimus Versus Paclitaxel Eluting Stents in an Unselected Population with Coronary Artery Disease in the Real World: A Prospective Non-randomized Registry in Southern Turk
... Med Sci 2011, 70 Statistical Analysis All statistical analyses were performed with SPSS for Windows (version 10.0, Chicago, USA) Continuous variables were described as mean ± standard deviation ... results of these initial trials indicate that the ZES is safe and reduces the rates of clinical and angiographic restenosis in patients with symptomatic coronary artery disease (CAD; 4) Also ... myocardial infarction, target vessel revascularization (TVR) Target vessel revascularization was defined as being either percutaneous or surgical revascularization of the stented epicardial vessel...
- 6
- 550
- 0
Báo cáo y học: " Mutation Analysis of hCDC4 in AML Cells Identifies a New Intronic Polymorphis"
... Nateri AS, Riera-Sans L, Da Costa C, Behrens A The ubiquitin ligase SCFFbw7 antagonizes apoptotic JNK signaling Science 2004;303(5662) :137 4-8 Tsunematsu R, Nakayama K, Oike Y, Nishiyama M, Ishida ... Yada M, Hatakeyama S, Kamura T, Nishiyama M, Tsunematsu R, Imaki H, Ishida N, Okumura F, Nakayama K, Nakayama KI Phosphorylation-dependent degradation of c-Myc is mediated by the F-box protein ... we subsequently confirmed by sequencing DNA samples of 51 healthy individuals Interestingly, this SNP had not yet been registered in any SNP databases despite of its high frequency of 20% in samples...
- 4
- 393
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose