... with the following primers: 5’-GCTCTAGATAGAAAAATTCCCCTCCACAATTAAAACTG-3’ (sense) and 5’-GTCCATGGCTGTAATTCAACACAACTGTTTAATAGTAC-3’ (antisense) Primers permitting the addition of a Flag tag at the ... (5’-GTTGCAACTCACAGTCTGGGGCAT-3’) and 24-7 (5’-AGATGCTGTTGAGCCTC AATAGCC-3’; the mutated nucleotide is indicated in bold), reverse PCR was used to mutate the cysteine residue in position 12 into ... very recent results support the notion that epitopes derived from antisense transcripts serve as CD8 T- cell targets in HIV-1 infection [21] Taken together, all these data suggest that the HIV-1...
... Article 112 Livingston et al 112.3 Despite the rapidity and sensitivity offered by systems that use microarray detection and identification, recent work has demonstrated that it is possible to ... HIV-1 infection in CD4+ Tcells to identify changes in host gene expression that were specific to HIV infection and that did not occur in cells that had been heat shocked, treated with interferon ... Database, for example, needs to be put together that sets out standards and requirements that would help such high-dimensional data to be translated into clinical utility Indeed, such information...
... in wild-type) In addition, substitution at positions )5 (P) and +4 (V) resulted in a moderate decrease in reactivity These results suggest that these amino acids contribute to the interaction of ... E51 with the enzyme to form an intermediate between the glutamine residue in the substrate and the cysteine residue in the active site pocket of TGase Assessment of reactivity and specificity of ... According to the FITC–pepE51 pattern, the activated TGase was mainly located in the medulla and the hair cortex However, according to the FITC–pepK5 pattern, TGase activity was observed around the outer...
... regulatory proteins Tat and Rev These studies show that RNAi can effectively trigger the degradation of not only viral mRNAs, but also genomic RNAs at both the pre- and post-integration stages of the viral ... different Biochemical Prevention and Treatment Targets of different Biochemical Prevention and Treatment strategies Antibodies (Ab) or soluble receptors (Rc) can inhibit the viral entry Antisense ... its potential as the next wave of Biochemical Prevention and Treatment http://www.virologyj.com/content/1/1/12 Competing Interests Dr Hervé Le Calvez declares that he has no competing interest Dr...
... regulatory proteins Tat and Rev These studies show that RNAi can effectively trigger the degradation of not only viral mRNAs, but also genomic RNAs at both the pre- and post-integration stages of the viral ... different Biochemical Prevention and Treatment Targets of different Biochemical Prevention and Treatment strategies Antibodies (Ab) or soluble receptors (Rc) can inhibit the viral entry Antisense ... its potential as the next wave of Biochemical Prevention and Treatment http://www.virologyj.com/content/1/1/12 Competing Interests Dr Hervé Le Calvez declares that he has no competing interest Dr...
... when the pellet that remained after extraction was separated by SDS-PAGE (not shown), indicating the efficiency of the extraction procedure with regard to Bet v To establish the identity of the ... Numbers indicate the relative amount of fragment variants compared to the total amount of homologues fragments Amounts were averaged over the two duplicates Note that quantification was not possible ... contaminated with other pollen proteins with a similar mass Three peptides of the pollen allergen Bet v were detected in the 1618 kDa band, but the amount of Bet v was estimated to be less than...
... group and was capable of relatively independent reproduction in the cytoplasm of the host cells, the exact identity of the host notwithstanding [6,8] In the last few years, the NCLDV attracted ... competing interests Authors' contributions EVK designed the project; NY collected and analyzed data; YIW wrote software and analyzed data; DR and EVK wrote the manuscript that was read and approved ... Additional File 3) The topologies of these gene content trees were generally compatible with that of the consensus tree (Figure 3), indicating that the evolution of the gene repertoire of the...
... developed on the high-throughput (200 tests/hour) and fully automated ARCHITECT® instrument system (Abbott Diagnostics, Dallas, TX) They are two-step chemiluminescent immunoassays (CMIAs) that utilize ... patterns and suitable control reagents to determine assay sensitivity and specificity The present study provides the first demonstration of seroconversion patterns in primates following infection ... WB strips with recombinant XMRV proteins Inhibitors of recombinant proteins and concentrations for specific strips are listed in the inserted table the WB method has the capacity to detect antibodies...
... 2-LTR circlea MH532 HIV F GAGTCCTGCGTCGAGAGAGC GTGCCCGTCTGTTGTGTGTGACT U5-U3 RNAa HIV R HIV F ACTGGTACTAGCTTGTAGCACCATCCA GTGCCCGTCTGTTGTGTGTGACT Gag HIV R For ACTGGTACTAGCTTGTAGCACCATCCA CCCATAGTGCAGAACATCCA ... T ATGCCACGTAAGCGAAACTCTGGCTAACT AGGGAACCCACTG TCCCAGCTACTGGGGAGGCTGAGG GCCTCCCAAAGTGCTGGGATTACAG ATGCCACGTAAGCGAAACT Linear HIV DNAa AA55M MH531 GCTAGAGATTTTCCACACTGACTAA TGTGTGCCCGTCTGTTGTGT ... ACTGGTACTAGCTTGTAGCACCATCCA CCCATAGTGCAGAACATCCA Singly splicedb Rev M669 GGGCTGAAAGCCTTCTCTTC GTGTGCCCGTCTGTTGTGTGACTCTGGTA AC GCCTATTCTGCTATGTCGACACC GACTCATCAAGTTTCTCTATCAAA La 23 Multiply spliced HIV RNAa P659 Unspliced...
... number not for citation purposes) Retrovirology 2008, 5:111 tors as attachment factors to facilitate their internalization Interestingly, ASLV Env is activated via the two-step mechanism that involves ... inactivated gp41 This notion is supported by the fact that antibodies against gp41 pre-bundles have been reported to react with gp41 outside the contact area between Env-expressing and target cells ... of infection as a function of coreceptor density indicates that recruitment of 4–6 mutant CCR5 with attenuated affinity to gp120 per virion leads to infection [102] On the other hand, the follow-up...
... primer: 5'-TTA CTA TTC TTT AGT TCC TGA CTC CAA TAC TGT AGG A-3' (start and stop in bold) The PCR products were transferred into the vector pENTR/SD/DTOPO of the Gateway® System (Invitrogen, Carlsbad, ... AAT AG-3' and 5'-CT ATT CCT TCG GGC CTG TGC GGT CCC CTC GGG GTT GGG AG3', R38A: 5'-GAG GGG ACC CGA CAG GCC GCA AGG AAT AGA AGA AGA AG-3' and 5'-CT TCT TCT TCT ATT CCT TGC GGC CTG TCG GGT CCC CTC-3', ... GCG AAT AGA AGA AGA AGG-3' and 5'-CCT TCT TCT TCT ATT CGC TCG GGC CTG TCG GGT CCC-3', R41A: 5'-GA CAG GCC CGA AGG AAT GCA AGA AGA AGG TGG AGA G-3' and 5'-C TCT CCA CCT TCT TCT TGC ATT CCT TCG GGC...
... find the differentially expressed genes In some cases, the data were put into a standardised pipeline, and in others the analysis was customised to this data set It is interesting to note that only ... correction Limma; FDR correction Limma; FDR correction Limma; FDR correction structural mixed model; FDR correction Student statistic; FDR correction Student statistic; Duval correction Student statistic; ... with no associated bene t It is clear from the relationship between M and A that an intensity dependent normalisation should be used on these data and most groups reflected that by choosing to...
... cells/ mL Three extracts TS, SG-A and SG-B were added to the chamber slide at their respective LC50 concentrations and untreated cells acted as control Untreated and treated cells were incubated ... Soyasaponins I and III extract treatment Hep-G2 cells were treated by Soyasaponins I and III extract at LC50 concentration determined the MTT analysis for 48 hours Untreated cells acted as controls Data ... found to be estrogenic and stimulated the growth of these cells In this chapter, I have The purpose of this chapter was to test the hypothesis (Objectives 1, and in Chapter 1) that refining an extraction...
... postures Mathie et al [42] also detected sit-stand/stand-sit transition activities instead of detecting sitting/standing static postures The transitions were detected in two steps using 27 a triaxial ... detected sit-stand/stand-sit transitions activities instead of detecting sitting/standing static postures The gyroscope measuring in sagittal plane was used to detect the locations of the transition ... classification for both sit-stand and stand-sit transition activities, but the most important limitation, in practice, of the above method is the integration error due to dc (steady state) component...
... understanding emotions In a nutshell, it considers the stimulus that excites the emotion, the cognition ability of the agent to appraise the nature of the stimulus and subsequently his/her mental and ... probability from state i to the state j x( t ) feature vector at time t bi ( x (t ) ) observation probability of the feature vector x( t ) given the state i ix List of Figures 1.1 Block diagram of the ... Silva and Dr Foo Say Wei for their encouragement and tremendous effort in getting me into the PhD program I am greatly indebted to them for their time and effort they spent with me over the past three...
... Construction of the feature vectors for samples Samples are the training, testing and independent data sets Both positive (1) and negative (2) data sets are compared to the reference data set (3) ... cross-reactivity, but are not limited to any distinct set of properties One of the main design objectives is to increase the sensitivity and the specificity of the method to sequences highly similar to ... limitations that its precision may be too low to be of practical use (Tong and Tammi, 2008) The best two methods in AlgPred are the amino acid composition approach, and the hybrid of the latter...
... subglutinans.(Nelson,1992;Agrios,2005).Fusariuminfectionscausedecayofthepith tissue in the lower stalk internodes and result in poor kernel fill and premature plant death.Thedecayofthemaizestalkaffectsthestructuralintegrityofthestalk,andthe plant is more prone to lodging. ... Ronaldinio and cv. Tassilo and Fusarium proliferatum and F. verticillioides.Intotal,twelvetreatmentswereused,witheachtreatmentreplicated6 times.Basedonresultsoftheaboveexperiment,themoresusceptiblestageofmaize ... severity of W and WL treatments ranged between 23.8 and 26.6%, but did not differ significantly between the two treatments (Table 2.6 and Fig. 2.6). No symptoms were detectedforthe4thleafinoculatedbycoating....