can apos t access a file look for spaces in the name
Báo cáo y học: " Open Access A key role for STIM1 in store operated calcium channel activation in airway smooth muscle" pptx
... the target gene was calculated using the comparative method (2∆∆Ct) [10] Primer and probe sequences: STIM-1 forward GCTCTTT primer: AAGGCTCTGGATACAGT- reverse primer: AGCATGAAGTCCTTGAGGTGATTAT ... ACGACACTTCCCAGGATAGCA reverse primer: GACTCCGGTCACTGATTTTCAAC probe: TGCACGAACCTTCATT Measurement of [Ca2+]i HASMs (passage 4–5) were plated in black walled, clear bottom 96 well plates and loaded with ... experiments Data are indicated as statistically significant with *P < 0.05 and **P < 0.01 located outside the cell or in the lumen of intracellular stores It is conceivable that STIM proteins may interact...
- 8
- 341
- 0
Laying the foundations a new era for rd in the middle east
... generate the ideas that will make the environment conducive to attracting potential investors “I think the challenge for us at this stage might be creating more interesting inventions that originate ... They are providing valuable incentives to multinationals and establishing science parks and other clusters to attract investment to the region In their turn, multinationals are realising that ... at KACST “One of the goals was to bring together the teams and to teach the KACST team the methods that IBM uses not just for conducting research, but for innovation in general,” says Dr Dalton...
- 42
- 221
- 0
A study on english acronnym in the name of international organizations
... ITO: International Trade Organization ITU: International Telecommunication Union LAES: Latin American Economic System LAFTA: Latin American Free Trade Association LAIA: Latin American Integration ... full at the first mention, with the acronym in brackets after it After that just the acronym is used 12 Chapter II: Name of international organizations I/ Name of international organizations stand ... tire of saying certain phrases over and over again, and almost automatically make them shorter or refer to them with initials But they forget that not everyone shares the same understanding There...
- 56
- 532
- 0
Health and Quality of Life Outcomes BioMed Central Research Open Access A new instrument for ppt
... individual patients from maintaining a PT-INR within therapeutic range Some of these aspects might be amenable to direct intervention; for example, those patients that find anticoagulation management ... application The clinical relevance of the DASS lies in its ability to summarize satisfaction with anticoagulation and in particular to help identify aspects of anticoagulation that may hinder individual ... develop and validate a scale that could be administered to anticoagulation patients generally; that is, across indication for anticoagulation and across models of anticoagulation management This...
- 11
- 361
- 0
Báo cáo y học: "Human cyclin T1 expression ameliorates a T-cell-specific transcriptional limitation for HIV in transgenic rats, but is not sufficient for a spreading infection of prototypic R5 " ppt
... strain may be feasible Moreover, the molecular characterization of such an adapted strain could greatly facilitate the identification of host determinants that are critical regulators of late ... observation warrants further investigations It will be interesting to investigate the genetic determinants in HIV-1R7/3 YU-2 Env GFP that underlie its ability to propagate in tg rat T- cells Through ... GCT TAT TTG, 3'-primer: CAG ATA GTC ACT ATA AGG ACG AAC) and selected for further matings with n-tg Sprague-Dawley rats Transgene expression in progeny was demonstrated by western blot detection...
- 19
- 263
- 0
Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"
... and RNA synthesis, and inosine that will be degraded into hypoxanthine and xanthine and finally into uric acid Hypoxanthine and guanine may enter in a salvage pathway, using hypoxanthine-guanine ... of patients which are at risk for TLS or have TLS and are allergic to allopurinol or cannot ingest it orally The risk-factors can be related to the tumour or to the subjects with cancer (Table ... several days after the end of chemotherapy, helps to dilute the excess of substances, to excrete them by an adequate urinary filtration rate and to prevent acute urate nephropathy, increasing intravascular...
- 11
- 715
- 0
Hoc T.a qua bai hat (fill in the blanks)
... gone And you know:* It's just too little too late A little too ……… And I can' t wait But you know all the right things to say (You know it's just too little too late)You say you dream of…………… face ... with me in the possibility * I don 't wanna be like this I just wanna …………… you know that everything that I hold in 'Cause ……………… that I can' t let go (can' t let go, yeah) * Don 't you know it baby ... But you don 't like me You just like the chase ………………… be real It doesn 't matter anyway (You know it's just too little too late) Yeaaah yeah It's just too little too late I was young and in...
- 3
- 655
- 1
Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests
... MRCWG have a role in liaising with IMO, FAO, NACA to enhance the effectiveness of existing instruments within APEC Institutional arrangements for managing the marine environment is fragmented in ... Pests Priorities and hazards for Economies Variable levels of activity and management capability Ships’ ballast water and hull fouling are the most important vectors International shipping, ... situation International fora collaboration Regional communication /technical support Institutional network strengthening Capacity building Management Framework - Introd uced Marine Pests Workshop,...
- 10
- 583
- 0
A study of difficulties in learning english listening skill for beginners in the asemlink of intrernational languages center and some suggested solutions
... introduces the aims to the thesis And the scope of the study gives the details about the objects that the thesis studies and the main content that the thesis covers Next, the methodology research is ... – Introduction will introduce the general information about the thesis First, the rationale is about the main reasons which enhance the author to this thesis Then, the purpose of the study introduces ... topics for further listening The authentic listening material is usually interesting because the listeners are exposed to the real life With the listening text in the text book, the teachers can...
- 96
- 10,573
- 53
Báo cáo khoa học: Structural evidence for a constant c11 ring stoichiometry in the sodium F-ATP synthase doc
... subunit c in the E coli host cells, indicating that intrinsic features of the monomeric unit determine the number of subunits that can be packed into the ring These data are fully compatible with the ... ⁄ PAGE The results (Fig 3) indicate that none of these enzymes significantly decreased the amount of the stable c11 aggregates A similar observation was made after incubating the sample for at ... additional subunits The AFM topographs indicate that these additional subunits may be hosted at the outer sides and within the central cavities of the rings That these bands are composed exclusively...
- 10
- 477
- 0
Báo cáo khoa học: "A Computational Framework for Composition in Multiple Linguistic Domains" doc
... operator combinations are given in Figure I n f o r m a t i o n S t r u c t u r e and Tactical Constraints Entries in the eategorial lexicon have tactical constraints, grammatical and semantic ... nprop |case none Lform g A special feature value called none is used for imposing certain morphotactic constraints, and to make sure that the stem is not inflected with the same feature more than ... this' ktz kedi-yi gSr-dii girl cat-ACC see-TENSE or ktz g6rdii kediyi 'The girl saw the cat' Fi As indicated by Turkish data in sections and 2, Fi may in fact have a domain larger than but compatible...
- 3
- 339
- 0
Báo cáo khoa học: Kinetic hybrid models composed of mechanistic and simplified enzymatic rate laws – a promising method for speeding up the kinetic modelling of complex metabolic networks pptx
... of the two external metabolites glucose and lactate in the blood Changes of the energetic load are due to changes in the activity of the Na+ K+-ATPase, accounting for about 70% of the total ATP ... If the change in the reaction rate is zero (meaning that the metabolite is neither a substrate nor an allosteric effector of the catalysing enzyme or, alternatively, that the enzyme is saturated ... with the metabolite), the corresponding saturation parameter is zero If, at the other extreme, the change in the reaction rate is proportional to the change in the concentration of the metabolite,...
- 15
- 456
- 0
Towards a safer use of the Internet for children in the EU – a parents’ perspective ppt
... Internet Another safety measure that parents with children that use the Internet can take is to set conditions about what they can or cannot on the Internet Parents were first asked whether there ... Safe Internet for children The use of monitoring and filtering software Half of the parents participating in this survey answered that they had installed filtering software on the computer that their ... of the Internet Three-quarters of the parents – with a child who accessed the Internet at home9 – said that they always or very frequently talked with their son or daughter about their online activities...
- 154
- 399
- 0
Báo cáo khoa học: "The Manually Annotated Sub-Corpus: A Community Resource For and By the People" potx
... associated with a set of GrAF standoff files, one for each annotation type, containing the annotations for that text In addition to the annotation types listed in Table 2, a document containing annotation ... appropriate metadata together with machine-processable information about associated annotations and interrelations among the annotation layers; and (2) a segmentation of the primary data into minimal regions, ... any format, either inline or standoff All contributed annotations are ported to GrAF standoff format so that they may be used with other MASC annotations and rendered in the various formats the...
- 6
- 374
- 0
steps to success writing a winning statement of purpose for students in the science technology engineering and math fiel
... programs Steps to Success Extenuating Circumstances “Extenuating circumstances that may have resulted in less than ideal academic credentials for graduate school.” Dr Liza Cariaga-Lo, Assistant Dean, ... "Nanotechnology is in our watches, cars, hospitals and it shuffles information around But it's also about therapies and new ideas — the next big thing that's going to change the world in 20 years." ... overly a general statement Steps to Success Strategy: Summarize Poster Abstracts One paragraph per abstract • • • • Explain why your work is important - set the context and preempt the question...
- 39
- 556
- 0
a field guide for science writers the official guide of the national association of science writers sep 2005
... National Aeronautics and Space Administration, the National Institutes of Health, the National Institutes of Standards and Technology, and the Department of Energy, which manages the national ... usually first scan the abstract and then read the introductory paragraphs to get a sense of the context for the research I then go to the conclusions section at the end, so I’ll know what the authors ... authors have to say about the ramifications of their work and what to pay attention to when reading the rest of the paper Then I’ll read the paper through, watching for things that might raise questions...
- 336
- 363
- 0
Báo cáo hóa học: "Distress or no distress, that''''s the question: A cutoff point for distress in a working population" pptx
... the other authors the study, collected and analyzed the data and drafted the manuscript; FJHvD contributed to the concept and design and drafted the manuscript; WBS contributed to the concept ... On the other hand, psychiatric illness can act as a stressor that aggravates strain and distress That may explain why individuals with depression and anxiety in many cases also exhibit distress ... management training may suggest a rather uniform set of intervention strategies, it usually refers to a mixture of treatment techniques To a certain extent these (work- Page of (page number not...
- 8
- 396
- 0
báo cáo hóa học: " Mild solutions for a problem involving fractional derivatives in the nonlinearity and in the non-local conditions" ppt
... derivatives whereas here we treat the fractional order case where some difficulties arise because of the non-local nature of the fractional derivatives In addition to that, to the best of the author’s ... Methods in Mathematical Analysis Transaction on Mathematical Monographs, American Mathematical Society, Providence 1964, 12 14 Hughes DK: Variational and optimal control problems with delayed arguments ... The author declares that they have no competing interests Acknowledgements The author is very grateful for the financial support provided by King Fahd University of Petroleum and Minerals through...
- 12
- 384
- 0
báo cáo hóa học:" Global existence and asymptotic behavior of smooth solutions for a bipolar Euler-Poisson system in the quarter plane" doc
... energy methods Then, we can establish the algebraical decay rate of the perturbed densities ϕ1 and ϕ2 Finally, from the estimates of the wave equation with damping in [20] and using the idea of ... obtain the asymptotic behavior and optimal decay rate, noting that E = ϕ1 − ϕ2 satisfies the damping “Klein-Gordon” equation (see [14, 15]), we first obtain the exponential decay rate of the electric ... models take an important place in the fields of applied and computational mathematics They can be derived from kinetic models by the moment method For more details on the semiconductor applications,...
- 22
- 366
- 0
Báo cáo y học: "Advanced paternal age is a risk factor for schizophrenia in Iranians" pps
... clinical sample data and drafted the manuscript BM participated in sample collection MN performed data analysis and CLS contributed to the editing and writing of the manuscript All authors read and ... environment to interact with the genome [36] The multiplicity of targets and modifications linked to epigenetic programming suggests that perturbations to such pathways are likely to account for a large ... for the first time that the relationship between birth order/rank and schizophrenia may be due to paternal age In fact, as advanced paternal age was a risk factor for schizophrenia, the disease...
- 6
- 405
- 0
Tìm thêm: khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008