calculation of the lagrange coefficients f and g and their time derivatives in terms of elapsed time
Báo cáo y học: "Bench-to-bedside review: Functional relationships between coagulation and the innate immune response and their respective roles in the pathogenesis of sepsis" ppsx
... physical damage to the integument of the animal, and it seals off the injured area from the remainder of the crab’s open circulatory system The animal will often clot off and sacrifice an entire ... converting factor X to factor Xa Factor Xa in the presence of factor Va forms a prothrombinconverting complex, resulting in thrombin formation and subsequent generation of a fibrin clot [2,53] TF–factor ... thrombin–thrombomodulin complex The TAFIa that is generated removes basic lysine and arginine residues from the carboxyl terminus of peptides and proteins In the case of fibrin, removal of carboxyl-terminal lysine...
- 16
- 347
- 0
Frequency of Routine and Flooding-stage Observations for Precise Annual Total Pollutant Loads and their Estimating Method in the Yodo River
... concentrations at the three transverse points with the change of flow during one of the five flooding events The data reflected the differences in traveling time of river water from their main pollutant ... periods of flooding in the routine observation period The frequency of flooding-stage observations was set close interval before the flow peak and thereafter long interval Such continuous flooding-stage ... extrapolating to both sides of the routine observation period and by compensating during flooding-stages using regression equations Especially, in the case of an excess of 268 m3/s (mean flow) over the...
- 9
- 572
- 0
Tài liệu Báo cáo khoa học: Post-translational modifications of the linker histone variants and their association with cell mechanisms docx
... parameters of the fibre formed by folding the zig-zagging chain of nucleosomes in inactive chromatin, the location of the linker histone in relation to the nucleosome core particle and linker DNA is still ... Historically, the location of the globular domain of the linker histone has been a matter of contention [13] Currently, although there is a good degree of agreement about the overall parameters of the ... do, in fact, contain a range of different types of PTM Returning to the issue of abundancy, Garcia et al [42] had to use two techniques to increase the number of peptides with certain PTMs First,...
- 13
- 633
- 0
Báo cáo khoa học: Deadenylation of interferon-b mRNA is mediated by both the AU-rich element in the 3¢-untranslated region and an instability sequence in the coding region pot
... structure obtained by oligomerization of a SalI linker was inserted in the HincII site of the pIFNHA construct located at the beginning of IFN-b mRNA 5¢UTR To place the IFN-b gene under the transcriptional ... were maintained in DMEM containing 10% of fetal bovine serum (FBS; Myoclone Super Plus, Life Technologies) and 1% of penicillin/ streptomycin The cells were infected by addition of 80 UặmL)1 of Sendaă ... 1A) We then analysed, by Northern blot, the induction and decay of IFN-b transcript in the same conditions As shown in Fig 1B, IFN-b mRNA was detectable h after the beginning of the infection,...
- 8
- 361
- 0
A Theoretical and Empirical Assessment of the Bank Lending Channel and Loan Market Disequilibrium in Poland doc
... Hence, following a monetary tightening, banks cannot offset a decline in deposits by simply adjusting their bond holdings and keeping their loan supply unaffected Similarly, firms cannot offset ... Second, the ratio of non-performing loans started to rise in December 1998, that is nine months before the beginning of a new stage of monetary tightening and exactly five months before the first signs ... attenuation effects of monetary policy shocks on banking reserves Second, a closer examination of (14) indicates that it is an increasing function of γ b and λb , and a decreasing function of λl and γ...
- 36
- 473
- 0
Báo cáo khoa học: Molecular dissection of the biosynthetic relationship between phthiocerol and phthiodiolone dimycocerosates and their critical role in the virulence and permeability of Mycobacterium tuberculosis doc
... GCTCTAGAGTTTAAACGATCTCATTGTTGGGGCGC GCTCTAGAGTTTAAACATAGTCAATGAACTTGTACGC AGGAAGGCCGGCAAATGGC TTCACGTGAGATAAGCTCCC ACGGTTTCGGTGAAGCCAG ACAATTAATTAACAGTATGTACGAGCGATGCG ACAAAAGCTTGGCGCAAATCATAGCTTCTTG GACTAGTTTAAACGGATCGACGAGTTCGACGC ... GACTAGTTTAAACGGATCGACGAGTTCGACGC GACTAGTTTAAACGAGGCACTGTGACCAGATGC CGTTCTGGAGCAACCTTCG GGTCGAGGAAGTACGTGAC GCTCTAGAGCAACCGTCCGAAATATTATAAA GCTCTAGATCTCATAAAAATGTATCCTAAATCAAATATC ppsE res 1966 FEBS Journal ... postinfection, we observed a marked difference between the number of CFUs of the wild-type strain and that of the PMM56 mutant strain in lungs and in the spleen (Fig 7A) Indeed, both strains...
- 13
- 536
- 0
A BRIEF HISTORY OF PANICS AND THEIR PERIODICAL OCCURRENCE IN THE UNITED STATES pdf
... disasters flowing from tariffs ranging between absolute protection, and those practically prohibiting, and intensified by the sufferings inseparable from war During this period agriculture, for the first ... those of the minority of the consumers of the country; the volume of business fell off, and a panic came in 1818 The influences that led up to it continued until 1846, as follows: The great factors ... an otherwise untoward effect of the new tariff upon farmers I have selected flour exports as the article best reflecting the chief interest of the farmers, and at the same time the state of general...
- 172
- 499
- 0
the mit ress vision and mind selected readings in the philosophy of perception sep 2002
... possible way of meeting the claim of x-ing to be the exercise of a new sense This, you will remember, took the form of arguing that x-ing, though perceiving, is merely perceiving by one of the familiar ... concerning the independence of these criteria, and in particular to the relation between the first and the second The first suggestion (that differing senses are to be distinguished by the differing features ... everything upside down; on the third day of the experiment, when things are beginning to regain their upright position, he is filled with the strange impression of looking at the fire out of the...
- 638
- 2,611
- 0
Báo cáo toán học: "Some Results on the Properties D3 (f ) and D4 (f )" ppsx
... of N ⊕ ( (I)⊗Π Lf (α, ∞)) and, hence, of ( (I) ⊕ K ⊕ (I))⊗Π Lf (α, ∞) The Main theorem is completely proved Acknowledgment The author would like to thank Prof Nguyen Van Khue for suggesting the ... Pham Hien Bang 144 Then R : (I)⊗Π Lf (α, ∞) → H0 is continuous linear and q ◦ R = id, Hence, R is the right inverse of q and the proposition is proved Proof of Main Theorem (i) The sufficiency ... sequence of Frechet spaces and continuous linear maps If E ∈ D4 (f ) then the sequence splits Proof Since E ∈ D4 (f ) and Lf (α, ∞) ∈ D3 (f ) (see Proposition 2.11 in [1]) then (E, Lf (α, ∞))...
- 9
- 276
- 0
báo cáo khoa học: "Fatty acid profiles and their distribution patterns in microalgae: a comprehensive analysis of more than 2000 strains from the SAG culture collection" docx
... large scale basis on either the profiles of lipids or FAs in microalgae Therefore, we determined the FA profiles of all available microalgal strains of the SAG culture collection of microalgae ... nutritional interest (Table 3) The frequency of occurrence of these four PUFAs in a certain group of microalgae is given as the percentage of strains with a certain FA from all examined strains in Table ... into a database to document the FA profiles of the studied microalgal strains Results and Discussion A database of FA profiles from diverse microalgae The characterisation of FA profiles of the...
- 16
- 617
- 0
Báo cáo y học: " T4 genes in the marine ecosystem: studies of the T4-like cyanophages and their role in marine ecology" doc
... proving the psbA gene is expressed during the infection cycle for the phage S-PM2 and that there is no loss in photosynthetic efficiency during the infection cycle [56] Further evidence for the function ... number of genes that may alter photosynthetic function In addition to maintaining PSII centres and altering bilin synthesis, a further mechanism for diverting the flow of electrons during photosynthesis ... to grazing Estimates of the relative effects of phage-induced lysis and grazing on marine cyanobacterial Page 13 of 19 assemblages vary widely e .g [89-91] and this probably reflects the fact the...
- 19
- 524
- 0
báo cáo khoa học: " Mapping of A1 conferring resistance to the aphid Amphorophora idaei and dw (dwarfing habit) in red raspberry (Rubus idaeus L.) using AFLP and microsatellite markers" ppt
... Jennings's hypothesis of linkage between this character and the H and T genes With a view to marker-assisted breeding and map-based gene cloning, there is interest in extending linkage maps to include ... 'Malling Jewel' and 'Malling Orion' raised as one of a series to investigate the distinctiveness of the different aphid resistance genes that have been used in the breeding programme at East Malling ... markers for map construction From the 24 AFLP primer combinations tested, a total of 114 segregating products were scored in the parents of the progeny Forty-five dominant markers segregated in 'M...
- 9
- 286
- 0
THE ROLE OF THE CTD PHOSPHATASE RTR1 AND POST-TRANSLATIONAL MODIFICATIONS IN REGULATION OF RNA POLYMERASE II
... following erg6Δ rtr1 in the presence of MG132 using Scaffold software 68 19 Ion fragmentation spectra obtained from LC-MS/MS for erg6Δ rtr1 in the presence of MG132 using Scaffold software ... for tandem affinity purification of tagged protein targets at the C-terminus of the endogenous locus with a TAP tag The TAP tag includes a Stapholococcus aureus calmodulin binding protein sequence ... begin to process the lengthening mRNA at the 5’ end As the RNAPII moves along the transcribed region of the gene, the shift of the CTD phosphorylated at serine to serine (S2-P) occurs through the...
- 109
- 206
- 0
A study on the linguistic features of the discourse marker but and their vietnamese translation equivalents
... equivalents - Discussing the findings in terms of relevance – theoretic view: basing on the similarities and differencies between English and Vietnamese in the ways of expressing the meanings to work out ... 1.2.2 Semantic Features In fact, learning a language includes ‘agreed – upon’ meanings of certain strings of sounds and learning how to comnine these meaningful units into larger units that also ... the information on discourse function is the most significant determinant in choosing the proper treatment of the marker: either insertion of a corresponding target language marker, modifying...
- 122
- 945
- 4
CONSUMERS'''' PERCEPTION OF THE FACTORS RISKING HEALTH AND THEIR RISK-REDUCING BEHAVIOUR
... Identifying the effects and ways of meeting risk information Assessing the creditability and the role of various information sources as well as examining the creditability and responsibility of various ... risks the following: inappropriate diet, insufficient quantity of food, or inappropriate circumstances of eating Food safety risk is defined as the possibility and the seriousness of a harmful effect ... by offering products from ecological faming The results of the survey made during the bird flu epidemic pointed out the guarantees offered by producers Consumers decreased their consumption of...
- 21
- 307
- 0
DSpace at VNU: Characterization of Fe-smectites and their alteration potential in relation to engineered barriers for HLW repositories: The Nui Nua clay, Thanh Hoa Province, Vietnam
... Semi-quantitative mineral compositions of the bulk samples and of the b2 μm fraction samples of these two clays Fig Geological map of the Nui Nua massif and the two sampling locations Adapted from Bach and ... (University of Freiburg, Germany) for the XRF data, Dr Le Thi Thu Huong for the FT-IR measurement, and Dr Barry Rawlins (British Geological Survey) for upgrading the use of English in the manuscript ... depends on the flow rate of overhead rotating or the energy of the hydraulic regime; the lower the flow rate, the larger the amount of dissolved Si resulting in neoformed montmorillonite The alteration...
- 9
- 146
- 0
DSpace at VNU: First study of the CP-violating phase and decay-width difference in B-s(0) - psi(2S)phi decays
... allows for the inclusion of information from both tagging algorithms in the computation of the decay rate The function X (t , ) is defined in Eq (1) and X (t , ) is the corresponding Bs function for ... support from CERN and from the national agencies: CAPES, CNPq, FAPERJ and FINEP (Brazil); NSFC (China); CNRS /IN2 P3 (France); BMBF, DFG and MPG (Germany); INFN (Italy); FOM and NWO (The Netherlands); ... propagated by repeating the fit using new sets of the ten integrals, I k , systematically varied according to their covariance matrix The effect of assuming perfect angular resolution in the likelihood...
- 10
- 130
- 0
DSpace at VNU: Quantum numbers of the X(3872) state and orbital angular momentum in its rho(0)J psi decay
... Kingdom); and NSF (U.S.) The Tier1 computing centers are supported by IN2 P3 (France), KIT and BMBF (Germany), INFN (Italy), NWO and SURF (The Netherlands), PIC (Spain) and GridPP (United Kingdom) ... The line shape of the ρ0 resonance can change slightly depending on the Xð3872Þ spin hypothesis The effect on ϵðΩÞ is very small and is neglected The angular correlations are obtained using the ... Gotti,20,e M Grabalosa G ndara,5 R Graciani Diaz,36 L A Granado Cardoso,38 E Graugés,36 E Graverini,40 G Graziani,17 A Grecu,29 E Greening,55 S Gregson,47 P Griffith,45 L Grillo,11 O Grünberg,63...
- 9
- 113
- 0
Báo cáo y học: " Predictors of hepatic steatosis in HBeAg-negative chronic hepatitis B patients and their diagnostic values in hepatic fibrosis"
... Glb+0.461FINS +e18.690-1.698TG-0.023GGT+0.083Glb-0.082FINS + 8.537-2.448TG-0.057GGT+0.034Glb+0.207FINS); e G2 : P2=e18.690-1.698TG-0.023GGT+0.083Glb-0.082FINS/(e-3.3-2.347TG-0.057+0.23 4Glb+0.461FINS ... +e18.690-1.698TG-0.023GGT+0.083Glb-0.082FINS + 8.537-2.448TG-0.057GGT+0.034Glb+0.207FINS); e G0 : P0=1/(e-3.3-2.347TG-0.057+0.234Glb+0.461FINS +e18.690-1.698TG-0.023GGT+0.083Glb-0.082FINS + e8.537-2.448TG-0.057GGT+0.034Glb+0.207FINS) ... Mass.) 273 with the fluorescent HBV DNA probes provided by the same company Asymmetric primer was 5′-TGTCTCGTGTTACAGGCGGGGT-3', asymmetric primer was 5′-GAGGCATAGCAGCAGGA GAAGAG-3', and fluorescent...
- 6
- 606
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25